oatx

Ensembl ID:
ENSDARG00000019713
ZFIN ID:
ZDB-GENE-070115-1
Description:
Oatx protein [Source:UniProtKB/TrEMBL;Acc:Q4VBJ1]
Human Orthologues:
SLC22A6, SLC22A8
Human Descriptions:
solute carrier family 22 (organic anion transporter), member 6 [Source:HGNC Symbol;Acc:10970]
solute carrier family 22 (organic anion transporter), member 8 [Source:HGNC Symbol;Acc:10972]
Mouse Orthologues:
Slc22a6, Slc22a8
Mouse Descriptions:
solute carrier family 22 (organic anion transporter), member 6 Gene [Source:MGI Symbol;Acc:MGI:89200
solute carrier family 22 (organic anion transporter), member 8 Gene [Source:MGI Symbol;Acc:MGI:13361

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa29669 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa29669
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044599 Essential Splice Site 136 526 3 14
Genomic Location (Zv9):
Chromosome 21 (position 42654014)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 44108838
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCATTTTAATAACATTAATTGCTTTTGAGGCAGTTCAATTAAGGAAGG[A/T]AGGAATAATTGACGACCGGATGTTGACTTACTATATATATAATGGACATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link