rhoua

Ensembl ID:
ENSDARG00000019709
ZFIN ID:
ZDB-GENE-040618-3
Description:
rho-related GTP-binding protein RhoU [Source:RefSeq peptide;Acc:NP_001007444]
Human Orthologue:
RHOU
Human Description:
ras homolog gene family, member U [Source:HGNC Symbol;Acc:17794]
Mouse Orthologue:
Rhou
Mouse Description:
ras homolog gene family, member U Gene [Source:MGI Symbol;Acc:MGI:1916831]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22288 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22288
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046360 Nonsense 193 254 3 3
Genomic Location:
Chromosome 13 (position 24596880)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGAGACCAGTTGAACCGCAGGATGCCAGCGTGTGCGCTGAAGAAGTC[C/T]AGGCTGTGTCGTACATGGAGTGTTCGGCGCTCACACAGAAAAACCTGAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Aging: Linkage and association of successful aging to the 6q25 region in large Amish kindreds. (View Study)
  • Basal cell carcinoma : Common variants on 1p36 and 1q42 are associated with cutaneous basal cell carcinoma but not with melanoma or pigmentation traits. (View Study)
  • Dental caries: Genome-wide association scan of dental caries in the permanent dentition. (View Study)
  • Endometriosis: Meta-analysis of genome-wide association scans for genetic susceptibility to endometriosis in Japanese population. (View Study)
  • Type 2 diabetes: Genome-wide association study identifies a novel locus contributing to type 2 diabetes susceptibility in Sikhs of Punjabi origin from India. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jknc6ooi