baz1a

Ensembl ID:
ENSDARG00000019699
ZFIN ID:
ZDB-GENE-030131-6105
Description:
Baz1a protein [Source:UniProtKB/TrEMBL;Acc:Q4V9B5]
Human Orthologue:
BAZ1A
Human Description:
bromodomain adjacent to zinc finger domain, 1A [Source:HGNC Symbol;Acc:960]
Mouse Orthologue:
Baz1a
Mouse Description:
bromodomain adjacent to zinc finger domain 1A Gene [Source:MGI Symbol;Acc:MGI:1309478]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19163 Essential Splice Site Mutation detected in F1 DNA During 2016
sa32127 Missense, Splice Site, Nonsense Mutation detected in F1 DNA During 2016
sa11550 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19163
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025390 Essential Splice Site 214 711 5 17
ENSDART00000121964   None 145 None 3
ENSDART00000123555 Essential Splice Site 214 365 4 10
ENSDART00000129274 Essential Splice Site 214 591 5 14
Genomic Location:
Chromosome 17 (position 10548060)
KASP Assay ID:
2261-0685.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAGCCCAGAGGCTTGCGAACCAGTAATAGTAAAAGTTGCTCAAATGAGG[T/G]GAGTTGTTGGTTGTTTACTTGTATTTTAAAATAAATACAATATATATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32127
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Missense, Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025390 Missense 312 711 9 17
ENSDART00000121964   None 145 None 3
ENSDART00000123555 Splice Site, Nonsense 338 365 8 10
ENSDART00000129274 Missense 312 591 9 14
Genomic Location:
Chromosome 17 (position 10551056)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTATCTGCATAAAACTGCTGTTTCTTTACATTTATTAAGAAAAATTCAG[A/T]AAAGAAAGAGATGATCTAATAGAGGCTAAGAAGAAAGAAAAAGAGGACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11550
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025390 Nonsense 640 711 15 17
ENSDART00000121964   None 145 None 3
ENSDART00000123555   None 365 None 10
ENSDART00000129274   None 591 None 14
Genomic Location:
Chromosome 17 (position 10554612)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCCAAACAGGAACTGCGAGAGCTTAAAGCTGAACAGCATCGCAGAGAG[C/T]GAGAGGAAGCTGCAGAGAGGTATGGCAKTACTTACACCTGCACTTACCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link