baz1a

Ensembl ID:
ENSDARG00000019699
ZFIN ID:
ZDB-GENE-030131-6105
Description:
Baz1a protein [Source:UniProtKB/TrEMBL;Acc:Q4V9B5]
Human Orthologue:
BAZ1A
Human Description:
bromodomain adjacent to zinc finger domain, 1A [Source:HGNC Symbol;Acc:960]
Mouse Orthologue:
Baz1a
Mouse Description:
bromodomain adjacent to zinc finger domain 1A Gene [Source:MGI Symbol;Acc:MGI:1309478]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19163 Essential Splice Site Mutation detected in F1 DNA During 2014
sa11550 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19163
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025390 Essential Splice Site 214 711 5 17
ENSDART00000121964 None None 145 None 3
ENSDART00000123555 Essential Splice Site 214 365 4 10
ENSDART00000129274 Essential Splice Site 214 591 5 14
Genomic Location:
Chromosome 17 (position 10548060)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAGCCCAGAGGCTTGCGAACCAGTAATAGTAAAAGTTGCTCAAATGAGG[T/G]GAGTTGTTGGTTGTTTACTTGTATTTTAAAATAAATACAATATATATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11550
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025390 Nonsense 640 711 15 17
ENSDART00000121964 None None 145 None 3
ENSDART00000123555 None None 365 None 10
ENSDART00000129274 None None 591 None 14
Genomic Location:
Chromosome 17 (position 10554612)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCCAAACAGGAACTGCGAGAGCTTAAAGCTGAACAGCATCGCAGAGAG[C/T]GAGAGGAAGCTGCAGAGAGGTATGGCAKTACTTACACCTGCACTTACCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/526cvrns