COLQ (1 of 2)

Ensembl ID:
ENSDARG00000019692
Description:
collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase [Source:
Human Orthologue:
COLQ
Human Description:
collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase [Source:
Mouse Orthologue:
Colq
Mouse Description:
collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase Gene [So

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22812 Splice Site, Nonsense Mutation detected in F1 DNA During 2014
sa2890 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22812
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006037 Splice Site, Nonsense 64 410 3 17
Genomic Location:
Chromosome 16 (position 22296539)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCTTCAGGGCCTCCTGGGCCCCCAGGACCAGCAGGACCTCCTGGCCCA[C/T]AGGTATGTGCTTCAGATGTGATGTAACTGTTATAGAAGGATTATAGAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2890
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006037 Nonsense 148 410 9 17
Genomic Location:
Chromosome 16 (position 22310908)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTACATTCAATATTACTTGATGTTGTTGTTTTAGGGTTCACAAGGTTTC[A/T]GAGGTGAAATTGGCTTAAAAGGTGACCGAGTAAGTTGTGTTTTAATGCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3648wlnr