COLQ (1 of 2)

Ensembl ID:
ENSDARG00000019692
Description:
collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase [Source:
Human Orthologue:
COLQ
Human Description:
collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase [Source:
Mouse Orthologue:
Colq
Mouse Description:
collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase Gene [So

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22812 Splice Site, Nonsense Mutation detected in F1 DNA During 2016
sa36097 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa22812
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006037 Splice Site, Nonsense 64 410 3 17
Genomic Location (Zv9):
Chromosome 16 (position 22296539)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 20402982
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCTTCAGGGCCTCCTGGGCCCCCAGGACCAGCAGGACCTCCTGGCCCA[C/T]AGGTATGTGCTTCAGATGTGATGTAACTGTTATAGAAGGATTATAGAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36097
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006037 Essential Splice Site 113 410 7 17
Genomic Location (Zv9):
Chromosome 16 (position 22310591)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 20417034
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAATGTTCTTTAGCTCATAGTGATGTTTGACCTCTGTATATTTTTAAC[A/G]GGGGGAGAAAGGTGACCCGGGATTGATGGGATTGCCAGGGGCTAGAGGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link