FGL2 (2 of 2)

Ensembl ID:
ENSDARG00000019686
Description:
fibrinogen-like 2 [Source:HGNC Symbol;Acc:3696]
Human Orthologue:
FGL2
Human Description:
fibrinogen-like 2 [Source:HGNC Symbol;Acc:3696]
Mouse Orthologue:
Fgl2
Mouse Description:
fibrinogen-like protein 2 Gene [Source:MGI Symbol;Acc:MGI:103266]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38069 Nonsense Mutation detected in F1 DNA During 2016
sa6131 Essential Splice Site Mutation detected in F1 DNA During 2016
sa24674 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa38069
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067277 Nonsense 5 434 1 7
Genomic Location (Zv9):
Chromosome 25 (position 21937556)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 21169432
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCCCTAACCCAACAACGATTGTGCAAAAACACCTACAAAACTCAATTG[G/A]TGTGATCCAACAAGCGTGGGTTAAATAAAAATAGTGTAATAATTTGAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6131
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067277 Essential Splice Site 201 434 6 7
Genomic Location (Zv9):
Chromosome 25 (position 21941031)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 21172907
KASP Assay ID:
554-3710.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTCTCAAAATGSAGCTAATGTGCAAGATTTGGATCAGGTTCAACAAGG[T/A]AAAACCCATGTTAGAGACAATAGTGAGGTTGTGTTGATACTTAACACTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24674
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067277 Nonsense 342 434 7 7
Genomic Location (Zv9):
Chromosome 25 (position 21943192)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 21175068
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATAGATGGTTACTCTGGTACAGCTGGCAATGCCATGCAATTTAGCAAA[A/T]AGTACAACCATGACCAGAAGTTCTTCACCACTCCGGACAGAGACAATGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link