FGL2 (2 of 2)

Ensembl ID:
ENSDARG00000019686
Description:
fibrinogen-like 2 [Source:HGNC Symbol;Acc:3696]
Human Orthologue:
FGL2
Human Description:
fibrinogen-like 2 [Source:HGNC Symbol;Acc:3696]
Mouse Orthologue:
Fgl2
Mouse Description:
fibrinogen-like protein 2 Gene [Source:MGI Symbol;Acc:MGI:103266]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6131 Essential Splice Site Mutation detected in F1 DNA During 2014
sa24674 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6131
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067277 Essential Splice Site 201 434 6 7
Genomic Location:
Chromosome 25 (position 21941031)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTCTCAAAATGSAGCTAATGTGCAAGATTTGGATCAGGTTCAACAAGG[T/A]AAAACCCATGTTAGAGACAATAGTGAGGTTGTGTTGATACTTAACACTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24674
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067277 Nonsense 342 434 7 7
Genomic Location:
Chromosome 25 (position 21943192)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATAGATGGTTACTCTGGTACAGCTGGCAATGCCATGCAATTTAGCAAA[A/T]AGTACAACCATGACCAGAAGTTCTTCACCACTCCGGACAGAGACAATGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/nhxydcto