ENSDARG00000019669

Ensembl ID:
ENSDARG00000019669
Human Orthologue:
CASKIN1
Human Description:
CASK interacting protein 1 [Source:HGNC Symbol;Acc:20879]
Mouse Orthologue:
Caskin1
Mouse Description:
CASK interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:2442952]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24770 Nonsense Available for shipment Available now
sa30407 Nonsense Mutation detected in F1 DNA During 2015
sa24771 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa24770
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048631 Nonsense 290 618 1 2
Genomic Location:
Chromosome Zv9_NA885 (position 11672)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCCAATGTGGCTTCTTACGCCACACTCACTCGCAAACCCGGCCGCAGT[C/T]AACCATCTTTCGCCTCCAGTGATCGCCATGTAGGCCGCAGTCATTCCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30407
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048631 Nonsense 341 618 1 2
Genomic Location:
Chromosome Zv9_NA885 (position 11825)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCTGCCCAAAGTGGAGTAACTTCATGTGGGGTTGAAACAGAGAGTGCT[G/T]GAAGTGTCCGAAGCATTGCAGCTCGACTAGAGAGCAGTACAGGAAGCCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24771
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048631 Nonsense 391 618 1 2
Genomic Location:
Chromosome Zv9_NA885 (position 11977)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAAAAAATACAGAGAACCGTAGGAGGACCACTAGCGACTGCTCCACATA[T/A]GAAACGAAGCATGCAGATCAAAACGTTAGTCCTTTGAGGCACCAACAAGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3zc3liek