NP_001170927.1

Ensembl ID:
ENSDARG00000019660
Description:
relaxin receptor 2 [Source:RefSeq peptide;Acc:NP_001170927]
Human Orthologue:
RXFP2
Human Description:
relaxin/insulin-like family peptide receptor 2 [Source:HGNC Symbol;Acc:17318]
Mouse Orthologue:
Rxfp2
Mouse Description:
relaxin/insulin-like family peptide receptor 2 Gene [Source:MGI Symbol;Acc:MGI:2153463]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35927 Nonsense Mutation detected in F1 DNA During 2017
sa42578 Nonsense Mutation detected in F1 DNA During 2017
sa22678 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35927
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016908 Nonsense 239 473 9 16
Genomic Location (Zv9):
Chromosome 15 (position 30999021)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31894673
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGACCCACCTCATGTAATCATCTTCACAGGTCAATGGTGAACACTTCTT[T/A]AGAAGCCCTTCCTTCTGCCAGACTCTGTGCCCATATGCCCTTTCTCAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42578
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016908 Nonsense 327 473 12 16
Genomic Location (Zv9):
Chromosome 15 (position 31004898)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31900550
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCGATAAAGGAACTGCCAGTCGGTATTTTCAAGGATTTACGGTCATTG[C/T]AAAGTCTGTAAGTAATCAGATGATTTAACAGCACTTATTGTATAAAGTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22678
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016908 Nonsense 349 473 13 16
Genomic Location (Zv9):
Chromosome 15 (position 31007572)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31903224
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCAAAACCCACTGGACCACATCCACCCTGGCCAGTTTAATCATCTAATT[C/T]AGCTCCAGTCTCTGTAAGTAACTGACTAACCTGAAATTTTTTATGCGATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link