si:ch73-111a8.1

Ensembl ID:
ENSDARG00000019658
ZFIN ID:
ZDB-GENE-050411-38
Human Orthologue:
POU2F2
Human Description:
POU class 2 homeobox 2 [Source:HGNC Symbol;Acc:9213]
Mouse Orthologue:
Pou2f2
Mouse Description:
POU domain, class 2, transcription factor 2 Gene [Source:MGI Symbol;Acc:MGI:101897]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36053 Essential Splice Site Mutation detected in F1 DNA During 2017
sa10161 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa36053
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049323 Essential Splice Site 123 695 6 17
ENSDART00000141032   None 485 None 15
Genomic Location (Zv9):
Chromosome 16 (position 12678604)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 11083847
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCATATTTTTCCTCTCTGCTGCTCTTTTTCTCTCTCTATCTCTCTCTA[G/A]TTGACTGCACTTTTGCCTGCACAGCAGCAGCTGCTCTTACAGCAGGCGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10161
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049323 Essential Splice Site 423 695 11 17
ENSDART00000141032 Essential Splice Site 324 485 10 15
Genomic Location (Zv9):
Chromosome 16 (position 12683937)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 11089180
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGCATTGAGACCAATGTCCGCGTCRCTCTGGAACACAGCTTTTTAGCG[G/A]TCAGAACATATGATTTCATAACCAATACAAACTYTACACAACYATATAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link