sept7b

Ensembl ID:
ENSDARG00000019649
ZFIN ID:
ZDB-GENE-061103-265
Description:
septin-7 isoform 2 [Source:RefSeq peptide;Acc:NP_001119922]
Human Orthologues:
SEPT7, SEPT7L
Human Descriptions:
septin 7 [Source:HGNC Symbol;Acc:1717]
septin 7-like [Source:HGNC Symbol;Acc:30810]
Mouse Orthologue:
Sept7
Mouse Description:
septin 7 Gene [Source:MGI Symbol;Acc:MGI:1335094]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10940 Essential Splice Site Available for shipment Available now
sa44249 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa10940
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032825 Essential Splice Site 82 429 3 13
ENSDART00000137437 Essential Splice Site 81 428 3 13
Genomic Location (Zv9):
Chromosome 25 (position 13070715)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 12783744
KASP Assay ID:
2261-9459.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTCCAAAGACTACCCTGGACCATCTCAGAGGATCAAGAAGACTGTTCAG[G/A]TATGTCCCCTTTTGCCGACCTCTGACCCCTGATACCGATCCACTGGTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44249
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032825 Nonsense 296 429 10 13
ENSDART00000137437 Nonsense 295 428 10 13
Genomic Location (Zv9):
Chromosome 25 (position 13091666)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 12762793
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCAGGACTCACATGCAGGACCTGAAGGACGTGACCAATAATGTTCACTA[C/A]GAAAACTACCGCAGTAAGAAACTAGCAGCCGTCACCTGCAACGGGGTCGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link