ldhba

Ensembl ID:
ENSDARG00000019644
ZFIN ID:
ZDB-GENE-991026-6
Description:
L-lactate dehydrogenase B-A chain [Source:UniProtKB/Swiss-Prot;Acc:Q9PVK4]
Human Orthologue:
LDHB
Human Description:
lactate dehydrogenase B [Source:HGNC Symbol;Acc:6541]
Mouse Orthologue:
Ldhb
Mouse Description:
lactate dehydrogenase B Gene [Source:MGI Symbol;Acc:MGI:96763]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13924 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13924
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010777 Essential Splice Site 279 334 7 8
Genomic Location:
Chromosome 4 (position 15898764)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTGGTGAAGAACCTGAACAGAGWCCACCCCGTGTCCACTATGGTGAAGG[T/A]RAGCTGAATTWACCAYGCTTCCATATCMTCGCACCTCACTGAATCGATAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vubupukn