rims2

Ensembl ID:
ENSDARG00000019622
ZFIN IDs:
ZDB-GENE-040426-1656, ZDB-GENE-040426-1656
Description:
Regulating synaptic membrane exocytosis 2 [Source:UniProtKB/TrEMBL;Acc:Q6PC83]
Human Orthologue:
RIMS2
Human Description:
regulating synaptic membrane exocytosis 2 [Source:HGNC Symbol;Acc:17283]
Mouse Orthologue:
Rims2
Mouse Description:
regulating synaptic membrane exocytosis 2 Gene [Source:MGI Symbol;Acc:MGI:2152972]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14738 Nonsense Available for shipment Available now
sa22936 Nonsense Mutation detected in F1 DNA During 2014
sa22935 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa14738
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016817 None None 286 None 6
ENSDART00000079296 Nonsense 237 1473 4 28
Genomic Location:
Chromosome 16 (position 47344082)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAAACCAAAAATACRACCAAAGGGAGGAGAAGGCGGWTCGTTCGCAGTA[T/A]GCACCAGGAGAGGGCGGCATGCCACGATCGCCGTCTGACTATGGAGCCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22936
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016817 None None 286 None 6
ENSDART00000079296 Nonsense 986 1473 18 28
Genomic Location:
Chromosome 16 (position 47268276)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGTTCAGACCAGCCCCACAGGGACCCCCATAAACAGCCGGAGAGGAAGA[C/T]AGCTGCCACAACTGCCTCCAAAGGGGACGCTGGAGAGAAGTATGTTTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22935
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016817 None None 286 None 6
ENSDART00000079296 Nonsense 1214 1473 23 28
Genomic Location:
Chromosome 16 (position 47215411)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGCCGTAAGCCTGGTGGGAACGGACGACAAGAAACGGCGCTCCAGCATC[G/T]GAGCTAAGATGGCGGCAGTGGTGGGATTGAGCCGAAAGAGTCGCAGCGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cqancmxz