phf16

Ensembl ID:
ENSDARG00000019614
ZFIN ID:
ZDB-GENE-030131-928
Description:
Protein Jade-3 [Source:UniProtKB/Swiss-Prot;Acc:Q7ZVP1]
Human Orthologue:
PHF16
Human Description:
PHD finger protein 16 [Source:HGNC Symbol;Acc:22982]
Mouse Orthologue:
Phf16
Mouse Description:
PHD finger protein 16 Gene [Source:MGI Symbol;Acc:MGI:2148019]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16861 Essential Splice Site Available for shipment Available now
sa18542 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16861
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023163 Essential Splice Site 96 795 5 13
ENSDART00000147826 Essential Splice Site 96 795 5 12

The following transcripts of ENSDARG00000019614 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 37446732)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 37520490
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGTGCAAGTGCTGGCCAGTCCAGACACTATCCCTCAGCCCTCTGTGAG[G/A]TATGTCACTTTGAGTATAAACTGGGNNNNNNNNNAGTATTGGACGTGYAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18542
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023163 Nonsense 782 795 12 13
ENSDART00000147826 Nonsense 782 795 12 12

The following transcripts of ENSDARG00000019614 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 37427676)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 37501434
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGGAGGAAGGACTCAAAACCAGAGAGGAGATTATGTCAAGTCTGCCAGT[C/T]GAGCAAAACACTCTTATGGCTCTAGGAYATCGGTGCAAAGGTGACAATCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link