COL12A1 (1 of 2)

Ensembl ID:
ENSDARG00000019601
Description:
collagen, type XII, alpha 1 [Source:HGNC Symbol;Acc:2188]
Human Orthologue:
COL12A1
Human Description:
collagen, type XII, alpha 1 [Source:HGNC Symbol;Acc:2188]
Mouse Orthologue:
Col12a1
Mouse Description:
collagen, type XII, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:88448]

Alleles

There are 20 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23815 Essential Splice Site Mutation detected in F1 DNA During 2014
sa23814 Nonsense Available for shipment Available now
sa6653 Nonsense Mutation detected in F1 DNA During 2014
sa13062 Essential Splice Site Available for shipment Available now
sa19246 Nonsense Mutation detected in F1 DNA During 2014
sa12086 Essential Splice Site Available for shipment Available now
sa10128 Essential Splice Site Available for shipment Available now
sa8361 Essential Splice Site Mutation detected in F1 DNA During 2014
sa4927 Essential Splice Site Mutation detected in F1 DNA During 2014
sa23813 Nonsense Mutation detected in F1 DNA During 2014
sa23812 Nonsense Mutation detected in F1 DNA During 2014
sa11564 Nonsense Available for shipment Available now
sa16630 Nonsense Available for shipment Available now
sa7944 Essential Splice Site Mutation detected in F1 DNA During 2014
sa17277 Essential Splice Site Available for shipment Available now
sa12359 Nonsense Available for shipment Available now
sa6652 Nonsense Mutation detected in F1 DNA During 2014
sa14083 Essential Splice Site Available for shipment Available now
sa19245 Essential Splice Site Mutation detected in F1 DNA During 2014
sa10401 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23815
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025926 Essential Splice Site 722 3643 10 76
Genomic Location:
Chromosome 20 (position 49961907)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAAAGGAGAAAGCTTTCCGCTATCAGGCTACGAGACCACACTTGACGG[T/C]ACGTGTCTGTATTATTCACATTCATTTTAGCACTTGAGTTTCTACAGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23814
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025926 Nonsense 1117 3643 15 76
Genomic Location:
Chromosome 20 (position 49926540)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCAGTTTCCGAGTGACGTGGGACCCCGCTCCCGGTGATGTGCGGGGATA[C/A]AAAGTCACCTTTCATCCCAGCGAAAATGATATTGATTTGGGAGAACTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6653
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025926 Nonsense 1452 3643 22 76
Genomic Location:
Chromosome 20 (position 49903892)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGYGAGGAAAACACACTTGTCCTGGTCAACCTGAACCCCATGACCGAGTA[T/A]ATCGTCAGGGTCTATGGAGTGATCGGGGAGGAGAGCAGCGAACCTTTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13062
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025926 Essential Splice Site 1566 3643 24 76
Genomic Location:
Chromosome 20 (position 49896651)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTGCAYGGAGWGGCGGCCAGCCAACCGCTCATTGACAGAGGAGTCACTC[G/A]TATGCTAGTCTTCYYAATGCTTTCWGATGGTTTCCATTTGTYATTGTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19246
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025926 Nonsense 1815 3643 30 76
Genomic Location:
Chromosome 20 (position 49880719)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAAAAAAGAACAGTGTCATTCTTCAGAAGCTGACCCCTAACACCCCATA[C/A]ACCATCACCGTGGCTGCCGTCTATCGCACTGGAGAAAGCAAAGACATTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12086
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025926 Essential Splice Site 2108 3643 37 76
Genomic Location:
Chromosome 20 (position 49867651)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGAYGCATTGCAAAAAGACGATGTTGATWKAACTATTGTTGTCTTCTT[A/G]GAACCTTTGGGTAGCGTGAGGAACCTGCAGGTWACAGATCCTACTATMAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10128
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025926 Essential Splice Site 2108 3643 37 76
Genomic Location:
Chromosome 20 (position 49867651)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGAYGCATTGCAAAAAGACGATGTTGATWKAACTATTGTTGTCTTCTT[A/G]GAACCTTTGGGTAGCGTGAGGAACCTGCAGGTWACAGATCCTACTATMAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8361
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025926 Essential Splice Site 2335 3643 41 76
ENSDART00000025926 Essential Splice Site 2335 3643 41 76
Genomic Location:
Chromosome 20 (position 49862943)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCAATACAAYGTCATTTATGTTCCTGTTGCMGGAGGTGCTGCAGGCCAG[G/A]TAATGASCTAAATCTTAATCATCTCAAATTGTCATTTTAATGAGTTAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4927
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025926 Essential Splice Site 2335 3643 41 76
ENSDART00000025926 Essential Splice Site 2335 3643 41 76
Genomic Location:
Chromosome 20 (position 49862943)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCAATACAAYGTCATTTATGTTCCTGTTGCCGGAGGTGCTGCAGGCCAG[G/A]TAATGACCTAAATCTTAATCATCTCAAATTGTCATTTTAATGAGTTAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23813
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025926 Nonsense 2372 3643 42 76
Genomic Location:
Chromosome 20 (position 49862747)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTACAAGGTCACTGTAGTACCAGTATATGCAGATGCTGAAGGAAAGAGA[C/T]AGTCAGCGAATGGAAAAACAAGTGTGTACCTCTAGTCAACACTTTGAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23812
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025926 Nonsense 2387 3643 43 76
Genomic Location:
Chromosome 20 (position 49862623)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCATTTCAGTTTTACCAATTTTCAGAGCCTCTGGGTGGAGTGAAGAACT[T/A]GCAGGTCACCGATCCCACAACCAGCTCACTGAAGGTGCGCTGGGAGCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11564
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025926 Nonsense 2537 3643 46 76
Genomic Location:
Chromosome 20 (position 49852492)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCAACCTCAACAATGCTTTCCTGGATCAGCTCGTTCCAGATACTCCGTA[T/G]TCGGTGAATGTGATGGCGGTGTATGCTGAWGGAGAAGGCCCAGGGATTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16630
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025926 Nonsense 2562 3643 47 76
Genomic Location:
Chromosome 20 (position 49852023)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACCACTTATAATAACTTGGCTTTNCGTAAATGTTGTCTGTTTCARTACCA[C/T]GAGCTGGAYCCAGGAATATGAGGGTCTTCGAAAYCACCACAAGCACCRTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7944
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025926 Essential Splice Site 2650 3643 48 76
Genomic Location:
Chromosome 20 (position 49848208)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTTTATCCCGAAGGACCTGGTGGWTCCCTGAACGGAAACGGAAAAACAC[G/T]TCAGTTTTTGTTACATTTTTCTAGGATTGCTATGCAAAGAATNNNNNNNTTAAGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17277
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025926 Essential Splice Site 2739 3643 50 76
Genomic Location:
Chromosome 20 (position 49845028)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAATATGATGGCGGWGTCAGCAAACCTCTCATCGGACAAGGAACAACAT[G/A]TATGTAAAGAAACAAAGCTCRTCTGATTTCATYGGACGTATCCCWTCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12359
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025926 Nonsense 2857 3643 54 76
Genomic Location:
Chromosome 20 (position 49833713)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTSAGCCRTTCTGTGCYTCAYGRAGCTGTTTTGTGTGTGCTCAGTGTGC[A/T]AAGGAGCAAAGGCAGATGTGGTTTTCCTCATCGATGGCTCCTGGAGTATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6652
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025926 Nonsense 2988 3643 56 76
Genomic Location:
Chromosome 20 (position 49829818)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAACAGATGGACGCTCYCAGGACGACGTGCATAAGAACGCTGCCAAGTTG[C/T]AGCACGCKGGTATATATGATCCACTTYCACACGTTAAAAGATGTGACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14083
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025926 Essential Splice Site 3297 3643 64 76
Genomic Location:
Chromosome 20 (position 49800960)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACATGCACGTCAGACAGTTCTGGACCCCCGGGCCCACAGGGGCCAGTGG[T/A]AAGTCAAATAAAGGAGGAATCTTTCTTATGGACCCTTTCACAAKACTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19245
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025926 Essential Splice Site 3348 3643 67 76
ENSDART00000025926 Essential Splice Site 3348 3643 67 76
Genomic Location:
Chromosome 20 (position 49791216)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCAAAAAGTTTGGATGCTTATTTGACAGCCCCTTTTCCTTTTTTCGCAC[A/C]GGGTCGTCAAGGTCCGAAGGGGGATCCAGGCGATGCTGGCTTACCTGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10401
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025926 Essential Splice Site 3348 3643 67 76
ENSDART00000025926 Essential Splice Site 3348 3643 67 76
Genomic Location:
Chromosome 20 (position 49791216)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCAAAAAGTTTGGATGCTTATTTGACAGCCCCTTTTCCTTTYTTCGCAC[A/C]GGGTCGTCAAGGTCCGAAGGGGGATCCAGGCGATGCTGGCTTACCTGGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/et4e4ra1