COL12A1 (1 of 2)

Ensembl ID:
ENSDARG00000019601
Description:
collagen, type XII, alpha 1 [Source:HGNC Symbol;Acc:2188]
Human Orthologue:
COL12A1
Human Description:
collagen, type XII, alpha 1 [Source:HGNC Symbol;Acc:2188]
Mouse Orthologue:
Col12a1
Mouse Description:
collagen, type XII, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:88448]

Alleles

There are 23 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32318 Essential Splice Site Available for shipment Available now
sa23815 Essential Splice Site Available for shipment Available now
sa23814 Nonsense Available for shipment Available now
sa37166 Essential Splice Site Mutation detected in F1 DNA During 2016
sa6653 Nonsense Mutation detected in F1 DNA During 2016
sa13062 Essential Splice Site Available for shipment Available now
sa37165 Nonsense Mutation detected in F1 DNA During 2016
sa43540 Essential Splice Site Mutation detected in F1 DNA During 2016
sa12086 Essential Splice Site Available for shipment Available now
sa10128 Essential Splice Site Available for shipment Available now
sa37164 Essential Splice Site Mutation detected in F1 DNA During 2016
sa23813 Nonsense Available for shipment Available now
sa23812 Nonsense Available for shipment Available now
sa11564 Nonsense Available for shipment Available now
sa16630 Nonsense Available for shipment Available now
sa43539 Essential Splice Site Mutation detected in F1 DNA During 2016
sa43538 Nonsense Mutation detected in F1 DNA During 2016
sa17277 Essential Splice Site Available for shipment Available now
sa12359 Nonsense Available for shipment Available now
sa6652 Nonsense Mutation detected in F1 DNA During 2016
sa14083 Essential Splice Site Available for shipment Available now
sa19245 Essential Splice Site Mutation detected in F1 DNA During 2016
sa10401 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa32318
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025926 Essential Splice Site 331 3643 8 76
Genomic Location (Zv9):
Chromosome 20 (position 49972022)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 49857055
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAACACAACCCCACGCATTAAACATGGCTCCTTTTTCTGTTTATTTTGC[A/T]GTCGTTGAACCAGCGTCAAACTTGCAAGTCACAGAGGTCGCGTCCAAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23815
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025926 Essential Splice Site 722 3643 10 76
Genomic Location (Zv9):
Chromosome 20 (position 49961907)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 49847040
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAAAGGAGAAAGCTTTCCGCTATCAGGCTACGAGACCACACTTGACGG[T/C]ACGTGTCTGTATTATTCACATTCATTTTAGCACTTGAGTTTCTACAGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23814
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025926 Nonsense 1117 3643 15 76
Genomic Location (Zv9):
Chromosome 20 (position 49926540)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 49811673
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCAGTTTCCGAGTGACGTGGGACCCCGCTCCCGGTGATGTGCGGGGATA[C/A]AAAGTCACCTTTCATCCCAGCGAAAATGATATTGATTTGGGAGAACTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37166
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025926 Essential Splice Site 1383 3643 20 76
Genomic Location (Zv9):
Chromosome 20 (position 49911867)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 49797000
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTGTGGACGACCTCACTGAAAATCTCTGTAACAGCGTTAAAGGCCCAG[G/T]TACAGTCACACACTTGACTAGTGTACAATTGAAGTTAGAATTATTCGCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6653
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025926 Nonsense 1452 3643 22 76
Genomic Location (Zv9):
Chromosome 20 (position 49903892)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 49789025
KASP Assay ID:
554-5114.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGYGAGGAAAACACACTTGTCCTGGTCAACCTGAACCCCATGACCGAGTA[T/A]ATCGTCAGGGTCTATGGAGTGATCGGGGAGGAGAGCAGCGAACCTTTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13062
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025926 Essential Splice Site 1566 3643 24 76
Genomic Location (Zv9):
Chromosome 20 (position 49896651)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 49781784
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTGCAYGGAGWGGCGGCCAGCCAACCGCTCATTGACAGAGGAGTCACTC[G/A]TATGCTAGTCTTCYYAATGCTTTCWGATGGTTTCCATTTGTYATTGTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37165
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025926 Nonsense 1641 3643 26 76
Genomic Location (Zv9):
Chromosome 20 (position 49893356)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 49778489
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCAACCTGCGCTCTCAGACCGAGTATGATGTTGCCGTCACTCCAGTTTA[C/A]GACGAGGGTTCAGGAAATCCCATGCTTGGCACTGCAATAACTGGTGAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43540
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025926 Essential Splice Site 1794 3643 29 76
Genomic Location (Zv9):
Chromosome 20 (position 49883155)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 49768288
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGCTACAAAGTCACCCACCAGCCCGTCGCTGGAGGAAAACCATTATCT[G/A]TAAGTTCAGCTGCCCCCAAATCTCCCTCCAGTGAGATCTTTTGAAGCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12086
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025926 Essential Splice Site 2108 3643 37 76
Genomic Location (Zv9):
Chromosome 20 (position 49867651)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 49752784
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGAYGCATTGCAAAAAGACGATGTTGATWKAACTATTGTTGTCTTCTT[A/G]GAACCTTTGGGTAGCGTGAGGAACCTGCAGGTWACAGATCCTACTATMAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10128
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025926 Essential Splice Site 2108 3643 37 76
Genomic Location (Zv9):
Chromosome 20 (position 49867651)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 49752784
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGAYGCATTGCAAAAAGACGATGTTGATWKAACTATTGTTGTCTTCTT[A/G]GAACCTTTGGGTAGCGTGAGGAACCTGCAGGTWACAGATCCTACTATMAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37164
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025926 Essential Splice Site 2244 3643 39 76
Genomic Location (Zv9):
Chromosome 20 (position 49863428)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 49748561
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATTACAAAGTGTTCTACATCCCGCAACCAGGAGATGCTGAGATGATGG[T/A]AGGATCTGAAGAACTAACTTCTAATGGCTTATATTAAGGTCCTTCCACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23813
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025926 Nonsense 2372 3643 42 76
Genomic Location (Zv9):
Chromosome 20 (position 49862747)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 49747880
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTACAAGGTCACTGTAGTACCAGTATATGCAGATGCTGAAGGAAAGAGA[C/T]AGTCAGCGAATGGAAAAACAAGTGTGTACCTCTAGTCAACACTTTGAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23812
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025926 Nonsense 2387 3643 43 76
Genomic Location (Zv9):
Chromosome 20 (position 49862623)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 49747756
KASP Assay ID:
2261-4959.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCATTTCAGTTTTACCAATTTTCAGAGCCTCTGGGTGGAGTGAAGAACT[T/A]GCAGGTCACCGATCCCACAACCAGCTCACTGAAGGTGCGCTGGGAGCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11564
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025926 Nonsense 2537 3643 46 76
Genomic Location (Zv9):
Chromosome 20 (position 49852492)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 49737625
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCAACCTCAACAATGCTTTCCTGGATCAGCTCGTTCCAGATACTCCGTA[T/G]TCGGTGAATGTGATGGCGGTGTATGCTGAWGGAGAAGGCCCAGGGATTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16630
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025926 Nonsense 2562 3643 47 76
Genomic Location (Zv9):
Chromosome 20 (position 49852023)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 49737156
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACCACTTATAATAACTTGGCTTTNCGTAAATGTTGTCTGTTTCARTACCA[C/T]GAGCTGGAYCCAGGAATATGAGGGTCTTCGAAAYCACCACAAGCACCRTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43539
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025926 Essential Splice Site 2651 3643 49 76
Genomic Location (Zv9):
Chromosome 20 (position 49847607)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 49732740
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACACAAGCCTCTAGCTGATATTTTGCTCTTACTTTGCATTTTCTGTTC[A/G]GTCGGTCTACTGGCACCTCAGAACCTGCGAGTCTCAGACGAGTGGTACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43538
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025926 Nonsense 2660 3643 49 76
Genomic Location (Zv9):
Chromosome 20 (position 49847579)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 49732712
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTACTTTGCATTTTCTGTTCAGTCGGTCTACTGGCACCTCAGAACCTG[C/T]GAGTCTCAGACGAGTGGTACACGCGCTTCCGTGTGTCCTGGGATCCTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17277
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025926 Essential Splice Site 2739 3643 50 76
Genomic Location (Zv9):
Chromosome 20 (position 49845028)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 49730161
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAATATGATGGCGGWGTCAGCAAACCTCTCATCGGACAAGGAACAACAT[G/A]TATGTAAAGAAACAAAGCTCRTCTGATTTCATYGGACGTATCCCWTCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12359
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025926 Nonsense 2857 3643 54 76
Genomic Location (Zv9):
Chromosome 20 (position 49833713)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 49718846
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTSAGCCRTTCTGTGCYTCAYGRAGCTGTTTTGTGTGTGCTCAGTGTGC[A/T]AAGGAGCAAAGGCAGATGTGGTTTTCCTCATCGATGGCTCCTGGAGTATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6652
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025926 Nonsense 2988 3643 56 76
Genomic Location (Zv9):
Chromosome 20 (position 49829818)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 49714951
KASP Assay ID:
554-5399.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAACAGATGGACGCTCYCAGGACGACGTGCATAAGAACGCTGCCAAGTTG[C/T]AGCACGCKGGTATATATGATCCACTTYCACACGTTAAAAGATGTGACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14083
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025926 Essential Splice Site 3297 3643 64 76
Genomic Location (Zv9):
Chromosome 20 (position 49800960)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 49686183
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACATGCACGTCAGACAGTTCTGGACCCCCGGGCCCACAGGGGCCAGTGG[T/A]AAGTCAAATAAAGGAGGAATCTTTCTTATGGACCCTTTCACAAKACTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19245
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025926 Essential Splice Site 3348 3643 67 76
ENSDART00000025926 Essential Splice Site 3348 3643 67 76
Genomic Location (Zv9):
Chromosome 20 (position 49791216)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 49676439
KASP Assay ID:
2261-4951.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCAAAAAGTTTGGATGCTTATTTGACAGCCCCTTTTCCTTTTTTCGCAC[A/C]GGGTCGTCAAGGTCCGAAGGGGGATCCAGGCGATGCTGGCTTACCTGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10401
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025926 Essential Splice Site 3348 3643 67 76
ENSDART00000025926 Essential Splice Site 3348 3643 67 76
Genomic Location (Zv9):
Chromosome 20 (position 49791216)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 49676439
KASP Assay ID:
2261-4951.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCAAAAAGTTTGGATGCTTATTTGACAGCCCCTTTTCCTTTYTTCGCAC[A/C]GGGTCGTCAAGGTCCGAAGGGGGATCCAGGCGATGCTGGCTTACCTGGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link