si:dkey-193b15.9

Ensembl ID:
ENSDARG00000019596
ZFIN IDs:
ZDB-GENE-030131-8828, ZDB-GENE-030131-8828, ZDB-GENE-070912-417
Description:
Novel protein similar to vertebrate nardilysin (N-arginine dibasic convertase) (NRD1) [Source:UniPro
Human Orthologue:
NRD1
Human Description:
nardilysin (N-arginine dibasic convertase) [Source:HGNC Symbol;Acc:7995]
Mouse Orthologue:
Nrd1
Mouse Description:
nardilysin, N-arginine dibasic convertase, NRD convertase 1 Gene [Source:MGI Symbol;Acc:MGI:1201386]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39882 Splice Site, Nonsense Mutation detected in F1 DNA During 2017
sa15383 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39882
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005952 Splice Site, Nonsense 298 1109 10 34
ENSDART00000135754 Splice Site, Nonsense 280 1091 7 31
ENSDART00000140474   None 135 None 3
Genomic Location (Zv9):
Chromosome 2 (position 36555401)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 36852111
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCTTTGGCAGCCTCGCAAAGCCCGACCATCCTATGAGCAAATTCTGTT[G/A]GGGTAAGTTAAACATGCAGCGCTGCTTCAGAGTAGCTATTTAAATGGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15383
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005952 Nonsense 472 1109 16 34
ENSDART00000135754 Nonsense 454 1091 13 31
ENSDART00000140474   None 135 None 3
Genomic Location (Zv9):
Chromosome 2 (position 36557126)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 36853836
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTTTAGTATCTCCATCACAYTGACCGACGAGGGCTTCCAGAACTTCTA[T/A]GAGGTCTGTTAGGGGCAMTAACAGTCTAAAAACTGCATTGCTTTWGATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link