si:ch211-198d13.2

Ensembl ID:
ENSDARG00000019585
ZFIN ID:
ZDB-GENE-100922-14
Human Orthologue:
GSTK1
Human Description:
glutathione S-transferase kappa 1 [Source:HGNC Symbol;Acc:16906]
Mouse Orthologue:
Gstk1
Mouse Description:
glutathione S-transferase kappa 1 Gene [Source:MGI Symbol;Acc:MGI:1923513]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11353 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11353
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059187 Essential Splice Site 182 228 6 8
ENSDART00000136824 Essential Splice Site 197 242 6 8
Genomic Location (Zv9):
Chromosome 16 (position 33268607)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 31007122
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAATTAAAGACAAGCTGAARAGTGTCACACAGGAGGCACTAGAGAAAAAT[G/A]TTAGTGASTTTTATTTATGCCACAGCCTCCTTTCTGTCWACATTTTTTAW
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link