taf7

Ensembl ID:
ENSDARG00000019572
ZFIN ID:
ZDB-GENE-020419-18
Description:
transcription initiation factor TFIID subunit 7 [Source:RefSeq peptide;Acc:NP_775367]
Human Orthologue:
TAF7
Human Description:
TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 55kDa [Source:HGNC Symbol;
Mouse Orthologue:
Taf7
Mouse Description:
TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor Gene [Source:MGI Symbol;Acc

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2769 Essential Splice Site F2 line generated During 2014
sa7395 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa2769
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074498 Essential Splice Site 144 290 6 10
ENSDART00000128588 Essential Splice Site 144 362 6 13
ENSDART00000139397 Essential Splice Site 144 222 6 9

The following transcripts of ENSDARG00000019572 do not overlap with this mutation:

Genomic Location:
Chromosome 14 (position 42180671)
KASP Assay ID:
554-3449.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAAAAGAAAGACAAGGACAAAGACAAGAAATTTGTTTGGAACCACGGCA[G/A]TAAGCAGCTTCCTCTCCTCTACTGAAATATCATCWTAATTGGTTTCAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7395
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > G
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074498 Missense 228 290 10 10
ENSDART00000128588 Missense 228 362 10 13
ENSDART00000139397 None None 222 None 9

The following transcripts of ENSDARG00000019572 do not overlap with this mutation:

Genomic Location:
Chromosome 14 (position 42184430)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCCATGTAWAAAGTRTTCACACGTTTTTTTTNCCCCTAATTTAGTCCAA[C/G]ATGAYGAGCTTCGCGAGATCTTCAACGACATCAGCAGCAGCAGTGAGGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/119ii4qd