taf7

Ensembl ID:
ENSDARG00000019572
ZFIN ID:
ZDB-GENE-020419-18
Description:
transcription initiation factor TFIID subunit 7 [Source:RefSeq peptide;Acc:NP_775367]
Human Orthologue:
TAF7
Human Description:
TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 55kDa [Source:HGNC Symbol;
Mouse Orthologue:
Taf7
Mouse Description:
TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor Gene [Source:MGI Symbol;Acc

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7395 Missense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa7395
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > G
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074498 Missense 228 290 10 10
ENSDART00000128588 Missense 228 362 10 13
ENSDART00000139397   None 222 None 9

The following transcripts of ENSDARG00000019572 do not overlap with this mutation:

Genomic Location:
Chromosome 14 (position 42184430)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCCATGTAWAAAGTRTTCACACGTTTTTTTTNCCCCTAATTTAGTCCAA[C/G]ATGAYGAGCTTCGCGAGATCTTCAACGACATCAGCAGCAGCAGTGAGGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/119ii4qd