asap2b

Ensembl ID:
ENSDARG00000019564
ZFIN ID:
ZDB-GENE-030131-5060
Description:
ArfGAP with SH3 domain, ankyrin repeat and PH domain 2b [Source:RefSeq peptide;Acc:NP_001038398]
Human Orthologue:
ASAP2
Human Description:
ArfGAP with SH3 domain, ankyrin repeat and PH domain 2 [Source:HGNC Symbol;Acc:2721]
Mouse Orthologue:
6530401G17Rik
Mouse Description:
RIKEN cDNA 6530401G17 gene Gene [Source:MGI Symbol;Acc:MGI:1923478]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3052 Essential Splice Site F2 line generated During 2014
sa14060 Nonsense Available for shipment Available now
sa14030 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa3052
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101556 Essential Splice Site 370 1024 12 28
Genomic Location:
Chromosome 20 (position 29685995)
KASP Assay ID:
554-2583.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAAGTGAAGCGTAACCCAGATGAGAAAAAATGCTTTGATCTCATATCAC[G/A]TAATGTAGTTTTACAATCACAGCACAAAACTGWCATAAATTCACAGCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14060
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101556 Nonsense 385 1024 13 28
Genomic Location:
Chromosome 20 (position 29686156)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCTAGATGACAGAACGTATCACTTCCAGACTGAGGATGAGGCAGAGTG[T/A]CAGGTGTAAGTAWGTGCACATAKCRAGTGTGCMATTTCACATGAAATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14030
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101556 Nonsense 815 1024 23 28
Genomic Location:
Chromosome 20 (position 29695155)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGGTAGACARAGGTCATGTTCAGAWCCTGCAAACCCTCAAACTCCTGAA[C/T]AAAATAACTCTGTGTATGGTGAGTCTGACCTCCTGACAGCGACTTGATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6p402xft