clcn7

Ensembl ID:
ENSDARG00000019556
ZFIN ID:
ZDB-GENE-061103-196
Description:
H(+)/Cl(-) exchange transporter 7 [Source:RefSeq peptide;Acc:NP_001071005]
Human Orthologue:
CLCN7
Human Description:
chloride channel 7 [Source:HGNC Symbol;Acc:2025]
Mouse Orthologue:
Clcn7
Mouse Description:
chloride channel 7 Gene [Source:MGI Symbol;Acc:MGI:1347048]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2122 Essential Splice Site F2 line generated During 2014
sa20020 Nonsense Mutation detected in F1 DNA During 2014
sa14513 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa2122
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103660 Essential Splice Site 61 795 3 25
ENSDART00000126533 Essential Splice Site 61 795 3 26
ENSDART00000129235 Essential Splice Site 61 795 3 26

The following transcripts of ENSDARG00000019556 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 27818938)
KASP Assay ID:
554-3306.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGACTGTATGTTGCTGTTCATTCTCAGTTTGTCTTTTCCTAAATCGCAC[A/T]GGACATTATAAGAAGTCGACCGAAGGAAATCCCTCACAACGAAAAGCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20020
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103660 Nonsense 119 795 5 25
ENSDART00000126533 Nonsense 119 795 5 26
ENSDART00000129235 Nonsense 119 795 5 26

The following transcripts of ENSDARG00000019556 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 27821367)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCACAGGGCTTTAGATGCCTGGAGATCACACGATGGGTGATCTGCGGTT[T/A]GATTGGTTTACTCACCGGTCTCATCGCATGCTTGATAGACATTGCTGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14513
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103660 Essential Splice Site 186 795 7 25
ENSDART00000126533 Essential Splice Site 186 795 8 26
ENSDART00000129235 Essential Splice Site 186 795 7 26

The following transcripts of ENSDARG00000019556 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 27823577)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTAAATAATGWGGTATTTTWCTTTGAASATGATYATTTATTTTTTCACA[G/T]CCCATTGCTGCAGGAAGTGGAAWCCCTCAAATAAAATGCTATCTGAATGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3hqww253