pnp5b

Ensembl ID:
ENSDARG00000019553
ZFIN ID:
ZDB-GENE-040912-54
Description:
purine nucleoside phosphorylase 5b [Source:RefSeq peptide;Acc:NP_001004628]
Human Orthologue:
PNP
Human Description:
purine nucleoside phosphorylase [Source:HGNC Symbol;Acc:7892]
Mouse Orthologues:
Pnp, Pnp2
Mouse Descriptions:
purine-nucleoside phosphorylase 2 Gene [Source:MGI Symbol;Acc:MGI:3712328]
purine-nucleoside phosphorylase Gene [Source:MGI Symbol;Acc:MGI:97365]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19914 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19914
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024204 Essential Splice Site 65 294 3 6
Genomic Location (Zv9):
Chromosome 2 (position 58859947)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 58262764
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGGTGTAAACAAGCCTGAACTCACACTCATCTAACCGCTTGTGTTTTA[G/A]TGCACGGCCACGCTGGAAAGCTGGTGTTCGGCACACTAAAAGGAAAGCCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link