si:ch211-168m18.1

Ensembl ID:
ENSDARG00000019549
ZFIN ID:
ZDB-GENE-070705-78
Description:
Phosphatidate cytidylyltransferase [Source:UniProtKB/TrEMBL;Acc:A5PN44]
Human Orthologue:
CDS1
Human Description:
CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 1 [Source:HGNC Symbol;Acc:1800]
Mouse Orthologue:
Cds1
Mouse Description:
CDP-diacylglycerol synthase 1 Gene [Source:MGI Symbol;Acc:MGI:1921846]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40520 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40520
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017451 Essential Splice Site 387 431 11 12
Genomic Location (Zv9):
Chromosome 5 (position 41635750)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 39410467
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTATCTGATGGCGACATTCGTTCATGTTTACATAACAAGTTTTATCAGG[T/A]GAGAAAATCAGGTTACTCTTAACATCAGCCATCCAAATACATCAAATAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link