gpt2l

Ensembl ID:
ENSDARG00000019541
ZFIN ID:
ZDB-GENE-050302-11
Description:
Alanine aminotransferase 2-like [Source:UniProtKB/Swiss-Prot;Acc:Q6NYL5]
Human Orthologue:
GPT
Human Description:
glutamic-pyruvate transaminase (alanine aminotransferase) [Source:HGNC Symbol;Acc:4552]
Mouse Orthologue:
Gpt
Mouse Description:
glutamic pyruvic transaminase, soluble Gene [Source:MGI Symbol;Acc:MGI:95802]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14498 Nonsense Available for shipment Available now
sa3394 Nonsense Mutation detected in F1 DNA During 2014
sa5713 Nonsense F2 line generated During 2014
sa2059 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa14498
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005667 None None 566 None 12
ENSDART00000132572 None None 562 None 12
ENSDART00000133007 Nonsense 25 193 1 4

The following transcripts of ENSDARG00000019541 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 4027985)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGYTTTWAAATGGGGGAGWTGTGAGGCGGCTTAYGCGGCGGCGTACCCC[A/T]AGGTTCCTGACTGGGTTCTCAACTTTYCCCCGCTGCCTTCCCTTTCTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3394
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005667 Nonsense 161 566 4 12
ENSDART00000132572 Nonsense 157 562 4 12
ENSDART00000133007 Nonsense 144 193 3 4

The following transcripts of ENSDARG00000019541 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 4051634)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCACGCTCATAATTGGTTTGTTTTTCAAGGTGATGGCGCTGTGTACTTA[T/A]CCACAGCTACTTGAYGACAACAAGTTTCCAGAGGAKGCCAAAAACAGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5713
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005667 Nonsense 467 566 10 12
ENSDART00000132572 Nonsense 463 562 10 12
ENSDART00000133007 None None 193 None 4
ENSDART00000005667 Nonsense 467 566 10 12
ENSDART00000132572 Nonsense 463 562 10 12
ENSDART00000133007 None None 193 None 4

The following transcripts of ENSDARG00000019541 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 4062144)
KASP Assay ID:
554-3150.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCYGTTCTCAGTGCCTTGGCTGAAAAAGCCAAACTGACGGAGCAGATTT[T/A]GAACACAGTGCCAGGCATCAGCTGTAACCCAGTGCAGGGAGCCATGTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2059
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005667 Nonsense 467 566 10 12
ENSDART00000132572 Nonsense 463 562 10 12
ENSDART00000133007 None None 193 None 4
ENSDART00000005667 Nonsense 467 566 10 12
ENSDART00000132572 Nonsense 463 562 10 12
ENSDART00000133007 None None 193 None 4

The following transcripts of ENSDARG00000019541 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 4062144)
KASP Assay ID:
554-3150.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCYGTTCTCAGTGCCTTGGCTGAAAAAGCCAAACTGACGGAGCAGATTT[T/A]GAACACAGTGCCAGGCATCAGCTGTAACCCAGTGCAGGGAGCCATGTACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/nr74fd33