parp1

Ensembl ID:
ENSDARG00000019529
ZFIN ID:
ZDB-GENE-030131-3955
Description:
poly [Source:RefSeq peptide;Acc:NP_001038407]
Human Orthologue:
PARP1
Human Description:
poly (ADP-ribose) polymerase 1 [Source:HGNC Symbol;Acc:270]
Mouse Orthologue:
Parp1
Mouse Description:
poly (ADP-ribose) polymerase family, member 1 Gene [Source:MGI Symbol;Acc:MGI:1340806]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31048 Essential Splice Site Mutation detected in F1 DNA During 2017
sa12069 Nonsense Available for shipment Available now
sa11149 Nonsense Available for shipment Available now
sa23796 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31048
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017269 Essential Splice Site 96 1013 2 23
Genomic Location (Zv9):
Chromosome 20 (position 43684817)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 43755976
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCAAGAGAAAGTGAAGACAGCCATTGAGAGTGGAGGTGCTACAGGAGG[T/G]GATTTGTTTAAAATAGATATGATCTCCTATTTAGGTATACTGTGTTTTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12069
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017269 Nonsense 549 1013 12 23
Genomic Location (Zv9):
Chromosome 20 (position 43709504)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 43780663
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTTTGATTGYTCAGGTCTGGAAAACTGTGCTCATGTTCTGGAACAGAAT[G/T]GAAAGATTTACAGCGCCACACTGGGTCTCGTGGACATCGTCAGAGGGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11149
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017269 Nonsense 682 1013 14 23
Genomic Location (Zv9):
Chromosome 20 (position 43712933)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 43784092
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAAYCTGTGCAAGACCTCAWCCGAATGATCTTCGATGTGGAGAGCATG[A/T]AGAAAGCCATGGTGGAGTTTGAGGTTTGTTCACGTCCCTTTTCWATCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23796
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017269 Essential Splice Site 801 1013 17 23
Genomic Location (Zv9):
Chromosome 20 (position 43714883)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 43786042
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAGATCCCATTGACATCAACTATGAGAAACTCAAAACCAAAATTGAGG[T/C]AAAATGGCTTTGACTGCAAGAGCTATAAAGTTTTGTGTATGGTTACCACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Melanoma: Genome-wide association study identifies a new melanoma susceptibility locus at 1q21.3. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link