agfg1b

Ensembl ID:
ENSDARG00000019526
ZFIN ID:
ZDB-GENE-040426-1520
Description:
ArfGAP with FG repeats 1b [Source:RefSeq peptide;Acc:NP_956882]
Human Orthologue:
AGFG1
Human Description:
ArfGAP with FG repeats 1 [Source:HGNC Symbol;Acc:5175]
Mouse Orthologue:
Agfg1
Mouse Description:
ArfGAP with FG repeats 1 Gene [Source:MGI Symbol;Acc:MGI:1333754]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13458 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13458
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021158 Essential Splice Site 37 446 1 12
ENSDART00000092682 Essential Splice Site 56 547 1 17
ENSDART00000145107 Essential Splice Site 56 465 1 12
ENSDART00000146855 None None 262 None 7
Genomic Location:
Chromosome 2 (position 16281218)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCAACATGACAGTGGGCTCGTTTGTGTGCACCACCTGTTCCGGAATACT[G/T]TAAGTTTATAACGAGGGCAGTCATATTCACACAGATGGTGTATGAACTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7qnusbw8