si:ch73-37h15.1

Ensembl ID:
ENSDARG00000019525
ZFIN ID:
ZDB-GENE-100921-13
Human Orthologue:
TBCEL
Human Description:
tubulin folding cofactor E-like [Source:HGNC Symbol;Acc:28115]
Mouse Orthologue:
Tbcel
Mouse Description:
tubulin folding cofactor E-like Gene [Source:MGI Symbol;Acc:MGI:1925543]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33745 Nonsense Mutation detected in F1 DNA During 2017
sa2191 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa33745
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005696 Nonsense 159 426 4 7
ENSDART00000131274 Nonsense 161 428 6 9
Genomic Location (Zv9):
Chromosome 5 (position 66468908)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 62575691
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTGTACTTGTGGCTGTATTTCCATAGTCTGGAGGAGTTGTTTCTGTG[T/A]CTGAACGAGTATGAGAGCGTGAACGCCTCTTCTATGCCCTGCCCGTCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2191
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005696 Nonsense 297 426 6 7
ENSDART00000131274 Nonsense 299 428 8 9
Genomic Location (Zv9):
Chromosome 5 (position 66464848)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 62571631
KASP Assay ID:
554-2454.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTTGCCTCATGTGACTGTATTAAATGGCAGTGTTGTTACTGATGGAGAA[C/T]GAGAGGATGCAGAACGTTTTTTCATCCGCTACCATCTGGACTGCCCTGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link