mpx

Ensembl ID:
ENSDARG00000019521
ZFIN ID:
ZDB-GENE-030131-9460
Description:
eosinophil peroxidase [Source:RefSeq peptide;Acc:NP_997944]
Human Orthologues:
EPX, LPO, MPO
Human Descriptions:
eosinophil peroxidase [Source:HGNC Symbol;Acc:3423]
lactoperoxidase [Source:HGNC Symbol;Acc:6678]
myeloperoxidase [Source:HGNC Symbol;Acc:7218]
Mouse Orthologues:
Epx, Lpo, Mpo
Mouse Descriptions:
eosinophil peroxidase Gene [Source:MGI Symbol;Acc:MGI:107569]
lactoperoxidase Gene [Source:MGI Symbol;Acc:MGI:1923363]
myeloperoxidase Gene [Source:MGI Symbol;Acc:MGI:97137]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18566 Nonsense Available for shipment Available now
sa34835 Essential Splice Site Mutation detected in F1 DNA During 2016
sa21652 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa18566
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043961 Nonsense 53 893 4 15
ENSDART00000111058 Nonsense 53 762 4 16

The following transcripts of ENSDARG00000019521 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 6813068)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 7825868
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTCATTGATCTATCAGTTTTTTNAAATATATCTCYCAACCTTTAGGAGTT[T/A]AGCAAGGGTGCGCAAAGATGTCATTAAGCCTTCTGACAAGCTACGTCTGY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34835
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043961 Essential Splice Site 662 893 12 15
ENSDART00000111058 Essential Splice Site 662 762 12 16

The following transcripts of ENSDARG00000019521 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 6809798)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 7822598
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGCCTGCCTGATTTCAAGACAGTTCCAGAAAATCCGAGATGGCGATAG[G/A]TAACAATCTTTCAGTGTTTAGTAGGGGTGTTTAATTTTTCTCCTAGAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21652
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043961 Nonsense 869 893 15 15
ENSDART00000111058   None 762 16 16

The following transcripts of ENSDARG00000019521 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 6807862)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 7820662
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAGCTGAAGGGAAGGCAGTCCTGAGCCTACAGAGAGGAGACCGTGTGTA[T/A]GTGGAGGTTTCTCGAAGTGCTAATGGTATAGGCTTTTCAAGCTATTTCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link