mpx

Ensembl ID:
ENSDARG00000019521
ZFIN ID:
ZDB-GENE-030131-9460
Description:
eosinophil peroxidase [Source:RefSeq peptide;Acc:NP_997944]
Human Orthologues:
EPX, LPO, MPO
Human Descriptions:
eosinophil peroxidase [Source:HGNC Symbol;Acc:3423]
lactoperoxidase [Source:HGNC Symbol;Acc:6678]
myeloperoxidase [Source:HGNC Symbol;Acc:7218]
Mouse Orthologues:
Epx, Lpo, Mpo
Mouse Descriptions:
eosinophil peroxidase Gene [Source:MGI Symbol;Acc:MGI:107569]
lactoperoxidase Gene [Source:MGI Symbol;Acc:MGI:1923363]
myeloperoxidase Gene [Source:MGI Symbol;Acc:MGI:97137]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4358 Essential Splice Site Mutation detected in F1 DNA During 2014
sa18566 Nonsense Available for shipment Available now
sa4357 Nonsense Mutation detected in F1 DNA During 2014
sa21652 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4358
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043961 Essential Splice Site 51 893 3 15
ENSDART00000111058 Essential Splice Site 51 762 3 16

The following transcripts of ENSDARG00000019521 do not overlap with this mutation:

Genomic Location:
Chromosome 10 (position 6813167)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAAGCAAAGAAAATAGTRGACGCTGCTTACAAGTATTCTCGAGATGAG[T/A]GAGTAAAGTTTGTAAGAATGKTGCTCAGTACTCCTGTGTCACCATTCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18566
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043961 Nonsense 53 893 4 15
ENSDART00000111058 Nonsense 53 762 4 16

The following transcripts of ENSDARG00000019521 do not overlap with this mutation:

Genomic Location:
Chromosome 10 (position 6813068)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTCATTGATCTATCAGTTTTTTNAAATATATCTCYCAACCTTTAGGAGTT[T/A]AGCAAGGGTGCGCAAAGATGTCATTAAGCCTTCTGACAAGCTACGTCTGY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4357
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043961 Nonsense 145 893 5 15
ENSDART00000111058 Nonsense 145 762 5 16

The following transcripts of ENSDARG00000019521 do not overlap with this mutation:

Genomic Location:
Chromosome 10 (position 6812701)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCAAACCCGGCCACCATCTTGTAGGACCASACCCCTCATAAACAAGTAT[C/T]GAACTGCCAGCGGTGTCTGCAACAATCGGTCAGTCTTCTGGATGAAATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21652
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043961 Nonsense 869 893 15 15
ENSDART00000111058 None None 762 16 16

The following transcripts of ENSDARG00000019521 do not overlap with this mutation:

Genomic Location:
Chromosome 10 (position 6807862)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAGCTGAAGGGAAGGCAGTCCTGAGCCTACAGAGAGGAGACCGTGTGTA[T/A]GTGGAGGTTTCTCGAAGTGCTAATGGTATAGGCTTTTCAAGCTATTTCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/huzoe759