mcm5

Ensembl ID:
ENSDARG00000019507
ZFIN ID:
ZDB-GENE-021209-1
Description:
DNA replication licensing factor MCM5 [Source:RefSeq peptide;Acc:NP_848523]
Human Orthologue:
MCM5
Human Description:
minichromosome maintenance complex component 5 [Source:HGNC Symbol;Acc:6948]
Mouse Orthologue:
Mcm5
Mouse Description:
minichromosome maintenance deficient 5, cell division cycle 46 (S. cerevisiae) Gene [Source:MGI Symb

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa26067 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa26067
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024316 Essential Splice Site 252 736 5 16
Genomic Location (Zv9):
Chromosome 3 (position 27031707)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 25872529
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCGTTCCTCATGGAGAGATGCCACGACACATGCAGCTCTACTGCGACAG[G/A]TACATGTCACACACAACATATATAATCTCCTGAAGATCTATAGAGAAAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link