si:ch211-196o14.4

Ensembl ID:
ENSDARG00000019501
ZFIN ID:
ZDB-GENE-091112-9
Description:
im:7160157 (im:7160157), non-coding RNA [Source:RefSeq DNA;Acc:NR_023323]
Human Orthologue:
PCNXL3
Human Description:
pecanex-like 3 (Drosophila) [Source:HGNC Symbol;Acc:18760]
Mouse Orthologue:
Pcnxl3
Mouse Description:
pecanex-like 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1861733]

Alleles

There are 11 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43666 Essential Splice Site Mutation detected in F1 DNA During 2017
sa31058 Essential Splice Site Mutation detected in F1 DNA During 2017
sa37334 Nonsense Mutation detected in F1 DNA During 2017
sa43665 Nonsense Mutation detected in F1 DNA During 2017
sa8938 Nonsense Mutation detected in F1 DNA During 2017
sa37333 Nonsense Mutation detected in F1 DNA During 2017
sa43664 Nonsense Mutation detected in F1 DNA During 2017
sa11995 Nonsense Available for shipment Available now
sa10538 Nonsense Available for shipment Available now
sa37332 Essential Splice Site Mutation detected in F1 DNA During 2017
sa6677 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43666
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031456 Essential Splice Site 51 2237 1 32
ENSDART00000133441 Essential Splice Site 51 2269 1 33
ENSDART00000031456 Essential Splice Site 51 2237 1 32
ENSDART00000133441 Essential Splice Site 51 2269 1 33
Genomic Location (Zv9):
Chromosome 21 (position 27013941)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 27582852
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCTACCTCTGGATATTCCTCTTGGCCTTCCCCTTCCTTCTGTACATGG[T/C]GAGTTTTGCCTGAGGTAAAGAATATATAATGCAATGTATGTAATATTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31058
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031456 Essential Splice Site 51 2237 1 32
ENSDART00000133441 Essential Splice Site 51 2269 1 33
ENSDART00000031456 Essential Splice Site 51 2237 1 32
ENSDART00000133441 Essential Splice Site 51 2269 1 33
Genomic Location (Zv9):
Chromosome 21 (position 27013941)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 27582852
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCTACCTCTGGATATTCCTCTTGGCCTTCCCCTTCCTTCTGTACATGG[T/C]GAGTTTTGCCTGAGGTAAAGAATATATAATGCAATGTATGTAATATTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37334
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031456 Nonsense 163 2237 4 32
ENSDART00000133441 Nonsense 163 2269 4 33
Genomic Location (Zv9):
Chromosome 21 (position 27011111)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 27580022
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACTCTGACTCTTATCTTTTTCTTTTCCTCAGGAGTTTTTACCACAGCTT[G/T]AAGATCCCGGAGGTTCAAAGGGTACATTGTTGTGGTTATTGTTGCTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43665
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031456 Nonsense 232 2237 5 32
ENSDART00000133441 Nonsense 264 2269 6 33
Genomic Location (Zv9):
Chromosome 21 (position 27009973)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 27578884
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGATGAGAAGGACCTAGTGGACAATGGGGGTACAGATCAACTATCTCAG[C/T]AGAGCCCTGGTGTGGAGGGTTTAGGAGGCTACTCTCCCCTGGGACCTTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8938
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031456 Nonsense 239 2237 5 32
ENSDART00000133441 Nonsense 271 2269 6 33
Genomic Location (Zv9):
Chromosome 21 (position 27009951)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 27578862
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAATRGGGGTRCAGATCARCTATCTCAGCAGAGCCCTGGTGTGGAGGGTT[T/A]AGGAGGCTACTCTCCCCTGGGACCTTCGGCAGAATCTGAGAGCCTGGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37333
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031456 Nonsense 364 2237 5 32
ENSDART00000133441 Nonsense 396 2269 6 33
Genomic Location (Zv9):
Chromosome 21 (position 27009575)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 27578486
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCGTGTCTAATGCTGATCCTGCAGCTTTGCCTCAGGGCAAAGGCCCCTA[T/A]CAGCAGCCTGGAGATGTGCTGCAGGGTGGAAGTGACACAGATGACTTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43664
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031456 Nonsense 488 2237 5 32
ENSDART00000133441 Nonsense 520 2269 6 33
Genomic Location (Zv9):
Chromosome 21 (position 27009205)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 27578116
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTCTCTGCCCCGTCCTACCTCCTAGCAGAGCCTCCCTCTCTACAAGCA[C/T]AGCAGCAAGTGGTGCGACCGAAAGATCTGAAGCTGCTACGGGCCGGGGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11995
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031456 Nonsense 766 2237 6 32
ENSDART00000133441 Nonsense 798 2269 7 33
Genomic Location (Zv9):
Chromosome 21 (position 27008188)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 27577099
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAAGCATGACTCTGTTAGCAGTGTAAAGAGGACTCAGGCCATTCGAAGG[C/T]GACACAATGCTGGTAGTAACCCCACCCCACCCCCTTCYGCCATGGGCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10538
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031456 Nonsense 1315 2237 18 32
ENSDART00000133441 Nonsense 1347 2269 19 33
Genomic Location (Zv9):
Chromosome 21 (position 27004351)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 27573262
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTTCTGTGTCTCAGATGCTGCTCAGCTCATGTGGTTTGAGAAGCTGTA[C/A]GCTTGGCTGCAGTGTGTGGAGAAGTATTTCATCTATCCGGCTGTAGTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37332
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031456 Essential Splice Site 1667 2237 24 32
ENSDART00000133441 Essential Splice Site 1699 2269 25 33
Genomic Location (Zv9):
Chromosome 21 (position 26981382)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 27550293
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTTCAAGTGTTCGACCTACGCAAGATCCTCATCACATATTATGTCAAG[G/A]TCAGTTTCACTCAGACAAAAACAACTTAAATGAAAGGACTGCTGTCTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6677
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031456 Nonsense 1676 2237 25 32
ENSDART00000133441 Nonsense 1708 2269 26 33
Genomic Location (Zv9):
Chromosome 21 (position 26981272)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 27550183
KASP Assay ID:
554-5254.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGATCAAAGTCTGTCCTCCTCAGAGTATCATCTACTATGTGAGCCGCT[C/A]GYCCAAACTGGAGGAATGGTTAGCCAACGAAACGGTGCAGGAAGCGCTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link