cry5

Ensembl ID:
ENSDARG00000019498
ZFIN ID:
ZDB-GENE-010426-8
Description:
cryptochrome 5 [Source:RefSeq peptide;Acc:NP_571863]
Human Orthologues:
CRY1, CRY2
Human Descriptions:
cryptochrome 1 (photolyase-like) [Source:HGNC Symbol;Acc:2384]
cryptochrome 2 (photolyase-like) [Source:HGNC Symbol;Acc:2385]
Mouse Orthologues:
Cry1, Cry2
Mouse Descriptions:
cryptochrome 1 (photolyase-like) Gene [Source:MGI Symbol;Acc:MGI:1270841]
cryptochrome 2 (photolyase-like) Gene [Source:MGI Symbol;Acc:MGI:1270859]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21797 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21797
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023831 Nonsense 274 519 6 11
Genomic Location:
Chromosome 10 (position 40641837)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGGCTGCTTGTCTGCACGCACCTTCTGGTGGAGGCTCGCAGACGTGTAC[A/T]GAGGGGTGTGTGCCTGCTTGAGTTACATTAGTAATTTGTCAACTTGAGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/b5e4foje