esd

Ensembl ID:
ENSDARG00000019496
ZFIN ID:
ZDB-GENE-050417-328
Description:
S-formylglutathione hydrolase [Source:RefSeq peptide;Acc:NP_001017796]
Human Orthologue:
ESD
Human Description:
esterase D [Source:HGNC Symbol;Acc:3465]
Mouse Orthologue:
Esd
Mouse Description:
esterase D/formylglutathione hydrolase Gene [Source:MGI Symbol;Acc:MGI:95421]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21493 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21493
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012582 Nonsense 114 282 5 9
ENSDART00000115287 Nonsense 166 334 5 9
ENSDART00000131427 Nonsense 142 266 5 8
ENSDART00000141837 Nonsense 114 233 4 7
Genomic Location:
Chromosome 9 (position 26212420)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTTTGGGACAGGAGCCGGATTTTATGTAAATGCTACCCAAGATCCTTG[G/A]AAAACCAACTACCGCATGTATTCATATGTCACAGAGGAGGTGTGTAATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9prmmpa2