shbg

Ensembl ID:
ENSDARG00000019492
ZFIN ID:
ZDB-GENE-030131-1324
Description:
sex hormone binding globulin [Source:RefSeq peptide;Acc:NP_001007152]
Human Orthologue:
SHBG
Human Description:
sex hormone-binding globulin [Source:HGNC Symbol;Acc:10839]
Mouse Orthologue:
Shbg
Mouse Description:
sex hormone binding globulin Gene [Source:MGI Symbol;Acc:MGI:98295]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38888 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38888
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020942 Essential Splice Site 58 381 2 8
Genomic Location (Zv9):
Chromosome 12 (position 23876628)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 22399790
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATGGACACCTGCGATGCAAACATGTGCAAACCTCTCTGACATCAGGAG[G/T]TTAGTTGATCATTTTCTAAATCCTAATTTATAGGTGTGGAAAATTATAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link