elf2a

Ensembl ID:
ENSDARG00000019459
ZFIN ID:
ZDB-GENE-040822-41
Description:
E74-like factor 2a (ets domain transcription factor) [Source:RefSeq peptide;Acc:NP_001004116]
Human Orthologue:
ELF2
Human Description:
E74-like factor 2 (ets domain transcription factor) [Source:HGNC Symbol;Acc:3317]
Mouse Orthologue:
Elf2
Mouse Description:
E74-like factor 2 Gene [Source:MGI Symbol;Acc:MGI:1916507]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22544 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22544
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038670 Essential Splice Site 251 514 7 9
Genomic Location:
Chromosome 14 (position 48988760)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAAGAATAAACCTGATATGAACTATGAGACAATGGGGAGAGCACTCAGG[T/C]AAGGATATAAATATTGATAAATGTTGTTTTAGATTTAATCAAGGTTAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8eg0415v