elf2a

Ensembl ID:
ENSDARG00000019459
ZFIN ID:
ZDB-GENE-040822-41
Description:
E74-like factor 2a (ets domain transcription factor) [Source:RefSeq peptide;Acc:NP_001004116]
Human Orthologue:
ELF2
Human Description:
E74-like factor 2 (ets domain transcription factor) [Source:HGNC Symbol;Acc:3317]
Mouse Orthologue:
Elf2
Mouse Description:
E74-like factor 2 Gene [Source:MGI Symbol;Acc:MGI:1916507]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42448 Nonsense Mutation detected in F1 DNA During 2016
sa32002 Nonsense Mutation detected in F1 DNA During 2016
sa22544 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa42448
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038670 Nonsense 167 514 6 9
Genomic Location:
Chromosome 14 (position 48989102)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATTTGTTTAATGTGGTCCTCCCCAGCAGGACGAAAACCCAGGACTCCA[C/T]GAAATTGCTGTGATGGTTCTTTAGATTTGGTCTATAAAAGGAAATCTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32002
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038670 Nonsense 170 514 6 9
Genomic Location:
Chromosome 14 (position 48989091)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTGGTCCTCCCCAGCAGGACGAAAACCCAGGACTCCACGAAATTGCTG[T/A]GATGGTTCTTTAGATTTGGTCTATAAAAGGAAATCTAAAGACAGCAAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22544
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038670 Essential Splice Site 251 514 7 9
Genomic Location:
Chromosome 14 (position 48988760)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAAGAATAAACCTGATATGAACTATGAGACAATGGGGAGAGCACTCAGG[T/C]AAGGATATAAATATTGATAAATGTTGTTTTAGATTTAATCAAGGTTAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link