tfe3b

Ensembl ID:
ENSDARG00000019457
ZFIN ID:
ZDB-GENE-010919-3
Description:
transcription factor binding to IGHM enhancer 3b [Source:RefSeq peptide;Acc:NP_001038531]
Human Orthologue:
TFE3
Human Description:
transcription factor binding to IGHM enhancer 3 [Source:HGNC Symbol;Acc:11752]
Mouse Orthologue:
Tcfe3
Mouse Description:
transcription factor E3 Gene [Source:MGI Symbol;Acc:MGI:98511]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14907 Essential Splice Site Available for shipment Available now
sa4421 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa14907
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011250 Essential Splice Site 230 447 5 8
Genomic Location:
Chromosome 11 (position 26450216)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCAGAGCTTTCATGAAGGAGAGACAGAAGAAAGATAATCACAATCTCAG[T/C]GARTTCAAAACACASAGACTTCAGTAGCGTATTATTGTCTGTTTGTGTGW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4421
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011250 Essential Splice Site 230 447 6 8
Genomic Location:
Chromosome 11 (position 26450300)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGTCTGTTTGTGTGWCTGTGTGATTACATCTGTGCTTTGTTTTGTGAA[G/T]TTGAACGGCGGAGAAGATTCAACATAAATGACAGAATAAAGGAGYTAGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jm6e3pwr