tfe3b

Ensembl ID:
ENSDARG00000019457
ZFIN ID:
ZDB-GENE-010919-3
Description:
transcription factor binding to IGHM enhancer 3b [Source:RefSeq peptide;Acc:NP_001038531]
Human Orthologue:
TFE3
Human Description:
transcription factor binding to IGHM enhancer 3 [Source:HGNC Symbol;Acc:11752]
Mouse Orthologue:
Tcfe3
Mouse Description:
transcription factor E3 Gene [Source:MGI Symbol;Acc:MGI:98511]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14907 Essential Splice Site Available for shipment Available now
sa4421 Essential Splice Site Mutation detected in F1 DNA During 2016
sa35090 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa14907
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011250 Essential Splice Site 230 447 5 8
Genomic Location:
Chromosome 11 (position 26450216)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCAGAGCTTTCATGAAGGAGAGACAGAAGAAAGATAATCACAATCTCAG[T/C]GARTTCAAAACACASAGACTTCAGTAGCGTATTATTGTCTGTTTGTGTGW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4421
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011250 Essential Splice Site 230 447 6 8
Genomic Location:
Chromosome 11 (position 26450300)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGTCTGTTTGTGTGWCTGTGTGATTACATCTGTGCTTTGTTTTGTGAA[G/T]TTGAACGGCGGAGAAGATTCAACATAAATGACAGAATAAAGGAGYTAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35090
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011250 Nonsense 370 447 8 8
Genomic Location:
Chromosome 11 (position 26452985)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCAACATGGATGGAGCAATGGCACAGACTTCACCATCTCCTTTCCTCT[C/A]AGTACCTCCATCCGGCTCTCCGGCTGCTGTGGCTGTGAGCGGCCCGCTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link