rnf13

Ensembl ID:
ENSDARG00000019438
ZFIN ID:
ZDB-GENE-040426-772
Description:
ring finger protein 13 [Source:RefSeq peptide;Acc:NP_957338]
Human Orthologue:
RNF13
Human Description:
ring finger protein 13 [Source:HGNC Symbol;Acc:10057]
Mouse Orthologue:
Rnf13
Mouse Description:
ring finger protein 13 Gene [Source:MGI Symbol;Acc:MGI:1346341]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37566 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37566
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003303 Essential Splice Site 202 377 7 10
ENSDART00000130581 Essential Splice Site 202 377 6 10
ENSDART00000132108 Essential Splice Site 197 372 7 10

The following transcripts of ENSDARG00000019438 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 38048428)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 35187146
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCCTCATCATTGTGGGAATCTGCCTCATCCTCATCGTAGTTTTCATGG[T/G]GAGTCGTGTGCAATTATGCAGAAAACGATACCTGAAGAATATAGTTATGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link