eomesb

Ensembl ID:
ENSDARG00000019428
ZFIN ID:
ZDB-GENE-070318-1
Description:
eomesodermin homolog b [Source:RefSeq peptide;Acc:NP_001077044]
Human Orthologue:
EOMES
Human Description:
eomesodermin [Source:HGNC Symbol;Acc:3372]
Mouse Orthologue:
Eomes
Mouse Description:
eomesodermin homolog (Xenopus laevis) Gene [Source:MGI Symbol;Acc:MGI:1201683]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22970 Nonsense Available for shipment Available now
sa17035 Nonsense Available for shipment Available now
sa22969 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22970
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008317 Nonsense 36 534 1 6
Genomic Location (Zv9):
Chromosome 16 (position 58708237)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 55040051
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGAGAAAGTTTCTCCGGTAGTTTGTGGTGATGATCTGTCCAGCCGGTA[T/A]CTCCTGGACGGGCTGAGCTCCAGCCGCTACTTCATGCAGACGCAGGACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17035
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008317 Nonsense 358 534 6 6
Genomic Location (Zv9):
Chromosome 16 (position 58696547)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 55028361
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGCCTGCAGACTCCCCCCGAGCACAGCAGATGGTCCCGAAYGCTCGATA[C/A]GCCGYCCAGYCGTTCCTGCAGGAGCAGTTCAGCASTTTGACCCAGCGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22969
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008317 Nonsense 435 534 6 6
Genomic Location (Zv9):
Chromosome 16 (position 58696318)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 55028132
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTCCCTCTGCAGAGCTACTATCCCGACACTGCCTTCAGCTGGGGGACC[A/T]GAGTCTCCGCCGGCTCCTCGTTCCCCAGAAAACTACCCTCCGGCCTGCCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link