si:dkey-158b13.2

Ensembl ID:
ENSDARG00000019426
ZFIN ID:
ZDB-GENE-060503-334
Description:
Triple functional domain protein [Source:UniProtKB/Swiss-Prot;Acc:Q1LUA6]
Human Orthologue:
TRIO
Human Description:
triple functional domain (PTPRF interacting) [Source:HGNC Symbol;Acc:12303]
Mouse Orthologue:
Trio
Mouse Description:
triple functional domain (PTPRF interacting) Gene [Source:MGI Symbol;Acc:MGI:1927230]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36906 Nonsense Mutation detected in F1 DNA During 2017
sa32258 Nonsense Available for shipment Available now
sa36905 Nonsense Mutation detected in F1 DNA During 2017
sa12039 Nonsense Available for shipment Available now
sa23586 Nonsense Available for shipment Available now
sa12333 Nonsense Available for shipment Available now
sa11605 Nonsense Available for shipment Available now
sa36904 Nonsense Mutation detected in F1 DNA During 2017
sa36903 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36906
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087055 Nonsense 35 3087 1 57
ENSDART00000144275   None 3028 None 56
Genomic Location (Zv9):
Chromosome 19 (position 43526815)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 42405863
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAACGGCAATGTGGCGTCACTTTTGGACAACCACAGGTGGCAGTACGCA[C/T]AGACGGGCAACACGCTGATTCAGCTGCCAGGTAAAGCCTTGACGCCGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32258
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087055 Nonsense 213 3087 5 57
ENSDART00000144275 Nonsense 154 3028 4 56
Genomic Location (Zv9):
Chromosome 19 (position 43482543)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 42361591
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTTGACGGCTGACTTTGAGGGCAGCCTGGACTACAACCATGAAGAGTG[G/A]ATTGAAATCCGCGTGGCCTTCGAAGACTTTACAGGCAATGCTCGGCACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36905
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087055 Nonsense 649 3087 11 57
ENSDART00000144275 Nonsense 590 3028 10 56
Genomic Location (Zv9):
Chromosome 19 (position 43465092)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 42344140
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAATGCGGATAAGCTTCTGGAAGCGGCAGAGCAGCTGGCCCAGACAGGC[G/T]AGTGTGACCCAGAGGAGATCTATCAGGCCGCTCATCAGCTGGAGGACCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12039
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087055 Nonsense 836 3087 14 57
ENSDART00000144275 Nonsense 777 3028 13 56
Genomic Location (Zv9):
Chromosome 19 (position 43450714)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 42329762
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCGCAGCAGATGAATGAGTTTGATACAGAAGACCTGACGCTGGCTGAA[C/T]AGAGACTGCAGCACCAYGCTGATAAAGCCCTGACCATGAACAACCTGGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23586
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087055 Nonsense 1355 3087 25 57
ENSDART00000144275 Nonsense 1296 3028 24 56
Genomic Location (Zv9):
Chromosome 19 (position 43430029)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 42309077
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATCCCACCAGGCATCGTCAACAAAGAGCACATCATTTTTGGTAACATG[C/T]AAGATCTGTACGAGTTCCATCACAAGTGAGTTCAATCTTTCAGCCTGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12333
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087055 Nonsense 2160 3087 45 57
ENSDART00000144275 Nonsense 2101 3028 44 56
Genomic Location (Zv9):
Chromosome 19 (position 43399345)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 42278393
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGRTCATGTGCATTGTACCAAAAAGATGCAACGACATGATGAATGTTGGT[C/T]GACTCCAGGGGTTTGATGTAAGNNNNTGGTATTTTTCATACCAGTRGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11605
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087055 Nonsense 2320 3087 48 57
ENSDART00000144275 Nonsense 2261 3028 47 56
Genomic Location (Zv9):
Chromosome 19 (position 43393641)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 42272689
KASP Assay ID:
2261-3645.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGGTCCTGGTGTGWCAGGCAGCGGTGTACAGRCTGGAGGCAGCGGGGGG[C/T]AGATGATGGCCCCTGGAGGAGGAGTAGGGGTCYCGGCTGGGCCGGGTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36904
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087055 Nonsense 2422 3087 48 57
ENSDART00000144275 Nonsense 2363 3028 47 56
Genomic Location (Zv9):
Chromosome 19 (position 43393335)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 42272383
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAAACAGACGGACTCCCAACAGACAGAAAGCCCAGCCAAAGAGATCCCA[C/T]GAGCCACTGTGGCCCCGCTGGCTCTTGTCAAACCCAGACCTGGAACGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36903
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087055 Essential Splice Site 2615 3087 49 57
ENSDART00000144275 Essential Splice Site 2556 3028 48 56
Genomic Location (Zv9):
Chromosome 19 (position 43389719)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 42268767
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGACACACATCCGCCATCATCCCTGACGCTCCAGACGGAACCATAAAG[T/A]AAGAACGGTTACATAACACATGATGTTTGTGTTTTATATAGGCCATATAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link