cdc42bpb

Ensembl ID:
ENSDARG00000019383
ZFIN ID:
ZDB-GENE-030131-3647
Description:
serine/threonine-protein kinase MRCK beta [Source:RefSeq peptide;Acc:NP_001038590]
Human Orthologue:
CDC42BPB
Human Description:
CDC42 binding protein kinase beta (DMPK-like) [Source:HGNC Symbol;Acc:1738]
Mouse Orthologue:
Cdc42bpb
Mouse Description:
CDC42 binding protein kinase beta Gene [Source:MGI Symbol;Acc:MGI:2136459]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4887 Nonsense Mutation detected in F1 DNA During 2014
sa12889 Nonsense Available for shipment Available now
sa6626 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4887
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049437 Nonsense 473 1708 10 36
Genomic Location:
Chromosome 20 (position 18526809)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTCCCAGAATCCACTCAGGCTGTTCAATCTCTTCATGGCTCTGGTCGA[G/T]GAGCYGGCACTCTCGGACGAGATAAAGAGATTAAAAAACTTAATGAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12889
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049437 Nonsense 1105 1708 25 36
Genomic Location:
Chromosome 20 (position 18491632)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTTATACAGCCTTGTTTGTTGCTCCTCTTTCAGATCCCGAAGCCCACC[G/T]GAGTGAAGAAGGGCTGGCAGAGAGCATATGCTGWAGTKTGTGACTGTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6626
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049437 Nonsense 1671 1708 36 36
Genomic Location:
Chromosome 20 (position 18465658)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTAATTTTGTTTCTTTACCTGGTCTTTCCTCTGTAGCCCGACTCAGAYT[C/A]GACCAAGCATTCCACCCCCTCGAACAGCTCCAACCCCAGCAGCCCACCGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mt8n3ppi