flt1

Ensembl ID:
ENSDARG00000019371
ZFIN ID:
ZDB-GENE-050407-1
Description:
vascular endothelial growth factor receptor 1 [Source:RefSeq peptide;Acc:NP_001014829]
Human Orthologue:
FLT1
Human Description:
fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor recep
Mouse Orthologue:
Flt1
Mouse Description:
FMS-like tyrosine kinase 1 Gene [Source:MGI Symbol;Acc:MGI:95558]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8038 Nonsense Mutation detected in F1 DNA During 2014
sa1504 Essential Splice Site Available for shipment Available now
sa15078 Essential Splice Site Available for shipment Available now
sa301 Nonsense F2 line generated During 2014
sa12242 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa8038
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025621 Nonsense 61 1272 3 30
ENSDART00000130446 Nonsense 61 473 3 11
Genomic Location:
Chromosome 24 (position 22411275)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTACCCTAAACTTGATGTTTTAGGGGACGGTGGGAGCTCCAGTGGGTTT[T/A]GCCATCAGGCGTACCAAAACTCTACCCCGRCACACATATTGTGAACACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1504
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025621 Essential Splice Site 418 1272 9 30
ENSDART00000130446 Essential Splice Site 418 473 9 11
Genomic Location:
Chromosome 24 (position 22396549)
KASP Assay ID:
554-1429.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCAGTACGGRCTTTTCCAGAACCTCACCATCACACTGGTGGTAAATGG[T/G]GAGAGTCTGCTTTCATTAAACTACTTGATTGTGATTGGTTGAAAAAAAAG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa15078
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025621 Essential Splice Site 507 1272 11 30
ENSDART00000130446 None None 473 None 11
Genomic Location:
Chromosome 24 (position 22386305)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATCTTGACWATCAGCCACAGACAGGAAGTGTTAGAAGGGAAGAATAAG[G/A]TGAGTGTTCCAGTGGGTGGACTGATCATAGGGGACATGCCAAAYGATAMA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa301
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025621 Nonsense 683 1272 14 30
ENSDART00000130446 None None 473 None 11
Genomic Location:
Chromosome 24 (position 22376964)
KASP Assay ID:
554-3093.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCACTCTCCACTGCCCTGCTCGGGGAGTGCCACAGCCACACATAACATG[G/A]TATAAGAACCAAAGGAAGCTCCAGCAGGTGTCTGGTGAGACTAGGAAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12242
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025621 Essential Splice Site 922 1272 20 30
ENSDART00000130446 None None 473 None 11
Genomic Location:
Chromosome 24 (position 22371361)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTGTCTGCWTACCTCAAGAGTAAACGAGAAGTGTTCCTGTTGAATAGGG[T/C]TAGWCTGTTATTCTGTCTGTAATATCTATCTATCTMTCTATCTMTCTATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/14znilnz