tgfb3

Ensembl ID:
ENSDARG00000019367
ZFIN ID:
ZDB-GENE-030723-4
Description:
transforming growth factor beta-3 [Source:RefSeq peptide;Acc:NP_919367]
Human Orthologue:
TGFB3
Human Description:
transforming growth factor, beta 3 [Source:HGNC Symbol;Acc:11769]
Mouse Orthologue:
Tgfb3
Mouse Description:
transforming growth factor, beta 3 Gene [Source:MGI Symbol;Acc:MGI:98727]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
hu3526 Nonsense Confirmed mutation in F2 line Unknown
sa1467 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
hu3526
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019766 Nonsense 181 410 3 7
ENSDART00000147600 Nonsense 66 295 2 6

The following transcripts of ENSDARG00000019367 do not overlap with this mutation:

Genomic Location:
Chromosome 17 (position 52599463)
KASP Assay ID:
554-0143.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACGTGTGTTTTTACGGCAGATTCTCCGTCCTGATGAGCACATCGGCAAG[C/T]AGCGCTACATCGGCAGAAAAAACGTGATGATTGGAGGGACGGATGAGTGG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa1467
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019766 Nonsense 379 410 7 7
ENSDART00000147600 Nonsense 264 295 6 6

The following transcripts of ENSDARG00000019367 do not overlap with this mutation:

Genomic Location:
Chromosome 17 (position 52588253)
KASP Assay ID:
554-1392.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTACAACACGCTGAACCCRGAGGCGTCTGCGTCCCCCTGCTGCGTTCCT[C/T]AAGACCTGGAGCCGCTCACCATCCTCTACTACGTGGGCCGGACGCCTAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/novcdx1f