tgfb3

Ensembl ID:
ENSDARG00000019367
ZFIN ID:
ZDB-GENE-030723-4
Description:
transforming growth factor beta-3 [Source:RefSeq peptide;Acc:NP_919367]
Human Orthologue:
TGFB3
Human Description:
transforming growth factor, beta 3 [Source:HGNC Symbol;Acc:11769]
Mouse Orthologue:
Tgfb3
Mouse Description:
transforming growth factor, beta 3 Gene [Source:MGI Symbol;Acc:MGI:98727]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
hu3526 Nonsense Available for shipment Available now
sa36544 Essential Splice Site Mutation detected in F1 DNA During 2016
sa1467 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
hu3526
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019766 Nonsense 181 410 3 7
ENSDART00000147600 Nonsense 66 295 2 6

The following transcripts of ENSDARG00000019367 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 52599463)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 51999649
KASP Assay ID:
554-0143.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACGTGTGTTTTTACGGCAGATTCTCCGTCCTGATGAGCACATCGGCAAG[C/T]AGCGCTACATCGGCAGAAAAAACGTGATGATTGGAGGGACGGATGAGTGG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa36544
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019766 Essential Splice Site 214 410 3 7
ENSDART00000147600 Essential Splice Site 99 295 2 6

The following transcripts of ENSDARG00000019367 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 52599362)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 51999548
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTCCTTCGACGTCACTGAGACCGTACGAGAGTGGCTGACAAACAGAGG[T/C]CAGTCCCATTTAACACTTTAAACTCATCGGAAAGACTCTGGTGTTTTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1467
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019766 Nonsense 379 410 7 7
ENSDART00000147600 Nonsense 264 295 6 6

The following transcripts of ENSDARG00000019367 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 52588253)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 51988439
KASP Assay ID:
554-1392.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTACAACACGCTGAACCCRGAGGCGTCTGCGTCCCCCTGCTGCGTTCCT[C/T]AAGACCTGGAGCCGCTCACCATCCTCTACTACGTGGGCCGGACGCCTAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link