mbip

Ensembl ID:
ENSDARG00000019364
ZFIN ID:
ZDB-GENE-060810-43
Description:
Mbip protein [Source:UniProtKB/TrEMBL;Acc:Q6PG30]
Human Orthologue:
MBIP
Human Description:
MAP3K12 binding inhibitory protein 1 [Source:HGNC Symbol;Acc:20427]
Mouse Orthologue:
Mbip
Mouse Description:
MAP3K12 binding inhibitory protein 1 Gene [Source:MGI Symbol;Acc:MGI:1918320]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8516 Nonsense Mutation detected in F1 DNA During 2014
sa1018 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa8516
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008532 Nonsense 141 361 3 9
Genomic Location:
Chromosome 17 (position 38465698)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAGTTCCAACCCAGACATCGGTGAAAGGAAAGAARCTGCACMTACATCT[G/T]AGCAGATGKTTACKGATGATCCTCTTACATCTGACCACTGTGCTGCCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1018
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008532 Essential Splice Site 210 361 4 9
Genomic Location:
Chromosome 17 (position 38467443)
KASP Assay ID:
554-0922.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGAAAACAATGTGAGGGAGTTTTGCAACGTGATCGACTGCAATCAGGG[T/C]GAGAATGGGAGGGTATGGGCGGCWGGGGGGTGGTCAAAGGTATACTGCAC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Thyroid cancer: Discovery of common variants associated with low TSH levels and thyroid cancer risk. (View Study)
  • Thyroid hormone levels: A meta-analysis of thyroid-related traits reveals novel loci and gender-specific differences in the regulation of thyroid function. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8bv9uwk2