ptbp1a

Ensembl ID:
ENSDARG00000019362
ZFIN ID:
ZDB-GENE-050522-492
Description:
polypyrimidine tract binding protein 1a [Source:RefSeq peptide;Acc:NP_001018313]
Human Orthologue:
PTBP1
Human Description:
polypyrimidine tract binding protein 1 [Source:HGNC Symbol;Acc:9583]
Mouse Orthologue:
Ptbp1
Mouse Description:
polypyrimidine tract binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:97791]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17243 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17243
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017668 Essential Splice Site 249 574 8 16

The following transcripts of ENSDARG00000019362 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 26442453)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 26638649
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTCTGGTTCAATACTCAGACGGAATGACWGCTCAGCATGCAAAGCTGG[T/C]GAGTGGCACAGTGGAWCAATATATGAATGGATGAATGGGCAGCTAAATCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link