fabp1a

Ensembl ID:
ENSDARG00000019357
ZFIN ID:
ZDB-GENE-020318-3
Description:
Fatty acid binding protein 1-A, liver [Source:UniProtKB/Swiss-Prot;Acc:Q1AMT3]
Human Orthologue:
FABP1
Human Description:
fatty acid binding protein 1, liver [Source:HGNC Symbol;Acc:3555]
Mouse Orthologue:
Fabp1
Mouse Description:
fatty acid binding protein 1, liver Gene [Source:MGI Symbol;Acc:MGI:95479]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33780 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33780
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006606 Nonsense 89 127 4 6
Genomic Location (Zv9):
Chromosome 5 (position 75223829)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 71325071
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTGTGTGTGTGTGTGTGTTTTAGACTGTGGTTCAAATGGATGGTAAT[A/T]AGCTGACAGCGTTTGTCAAGGGGATTGAGTCTGTGACGGAGCTGGATGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link