mark3

Ensembl ID:
ENSDARG00000019345
ZFIN ID:
ZDB-GENE-030131-6232
Description:
MAP/microtubule affinity-regulating kinase 3 [Source:RefSeq peptide;Acc:NP_956179]
Human Orthologue:
MARK3
Human Description:
MAP/microtubule affinity-regulating kinase 3 [Source:HGNC Symbol;Acc:6897]
Mouse Orthologue:
Mark3
Mouse Description:
MAP/microtubule affinity-regulating kinase 3 Gene [Source:MGI Symbol;Acc:MGI:1341865]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11075 Essential Splice Site Available for shipment Available now
sa22253 Essential Splice Site Available for shipment Available now
sa3836 Essential Splice Site Mutation detected in F1 DNA During 2014
sa9017 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa11075
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013525 Essential Splice Site 260 722 8 16
ENSDART00000041293 Essential Splice Site 260 746 8 18
ENSDART00000087194 Essential Splice Site 260 503 8 13
ENSDART00000133342 None None 169 None 3
ENSDART00000134240 None None 195 None 6
ENSDART00000134972 None None 161 None 4
ENSDART00000138991 None None 177 None 3

The following transcripts of ENSDARG00000019345 do not overlap with this mutation:

Genomic Location:
Chromosome 13 (position 15588100)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTACACACTGGTCAGCGGCTCTCTACCTTTCGATGGACAGAATCTCAAGG[T/C]TTCACCCTCTTTTMTCAATGTATTTTTTTGTGTGAGTTTGTKTATGTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22253
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013525 Essential Splice Site 334 722 10 16
ENSDART00000041293 Essential Splice Site 334 746 10 18
ENSDART00000087194 Essential Splice Site 334 503 10 13
ENSDART00000133342 None None 169 None 3
ENSDART00000134240 None None 195 None 6
ENSDART00000134972 None None 161 None 4
ENSDART00000138991 None None 177 None 3

The following transcripts of ENSDARG00000019345 do not overlap with this mutation:

Genomic Location:
Chromosome 13 (position 15589012)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACCCTTCACTGAGCCAGATGCTGACATATCTGACCAGAAGAGAATTGG[T/C]AAGAGGAAATTAAGCAGCACTTCTTATTCATGCAGAAAAGAGAAAGAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3836
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013525 Essential Splice Site 524 722 None 16
ENSDART00000041293 Essential Splice Site 524 746 None 18
ENSDART00000087194 None None 503 None 13
ENSDART00000133342 None None 169 None 3
ENSDART00000134240 Essential Splice Site 26 195 None 6
ENSDART00000134972 None None 161 None 4
ENSDART00000138991 None None 177 None 3

The following transcripts of ENSDARG00000019345 do not overlap with this mutation:

Genomic Location:
Chromosome 13 (position 15610095)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAACAACACAGACCGCCTTTCTGTCATTCCTAATGGGAAGGAAAACAGG[T/C]AAAGTTTATCTCTGCCAAATCTGACACTTATTTTAACCATGTTCAAAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9017
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013525 Nonsense 612 722 16 16
ENSDART00000041293 Nonsense 636 746 18 18
ENSDART00000087194 None None 503 None 13
ENSDART00000133342 Nonsense 59 169 3 3
ENSDART00000134240 None 174 195 6 6
ENSDART00000134972 None 140 161 4 4
ENSDART00000138991 Nonsense 67 177 3 3

The following transcripts of ENSDARG00000019345 do not overlap with this mutation:

Genomic Location:
Chromosome 13 (position 15621582)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCATTCCTGTTGTGCTTCWTTTAAKAGTCGCCATGTATCTGGGGATCAG[C/T]AGAAAGATGAAGGGAAAGATGGAAAAGACGGRAAACCCCGCTCTCTCCGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bone mineral density: Genome-wide meta-analysis identifies 56 bone mineral density loci and reveals 14 loci associated with risk of fracture. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wtdxl7ao