chrnd

Ensembl ID:
ENSDARG00000019342
ZFIN ID:
ZDB-GENE-030131-6665
Description:
acetylcholine receptor subunit delta [Source:RefSeq peptide;Acc:NP_996947]
Human Orthologue:
CHRND
Human Description:
cholinergic receptor, nicotinic, delta [Source:HGNC Symbol;Acc:1965]
Mouse Orthologue:
Chrnd
Mouse Description:
cholinergic receptor, nicotinic, delta polypeptide Gene [Source:MGI Symbol;Acc:MGI:87893]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30106 Nonsense Mutation detected in F1 DNA During 2015
sa7519 Missense Mutation detected in F1 DNA During 2015
sa5078 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa30106
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015391 Nonsense 31 518 2 12
Genomic Location:
Chromosome 24 (position 25968587)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTTGCAGAATGTTGTGGCCGAAATGAAGAGGAGCGCCTCATCAATTA[T/A]CTTTTTAAGGAGCGTGGCTACAACAAAGAGCTTCGGCCGGTCCAAAATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7519
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
A > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015391 Missense 240 518 7 12
Genomic Location:
Chromosome 24 (position 25970444)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGCATCCCGAAAGAAAGCAACAAGCACCAGGATATCACCTTTTACCTG[A/T]TCATTAAGCGTAARCCGCTGTTCTACATYGTCAACATAATCATTCCCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5078
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015391 Nonsense 324 518 9 12
Genomic Location:
Chromosome 24 (position 25971454)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTGACAGGTATCTGATGTTTATCATGGTGTTGGTCACTGTGRTGGTGT[T/A]GAATTGTGTCATTGTGTTGAACCTGCATTTTCGGACGCCCAGCACACACG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/65w0vrv8