chrnd

Ensembl ID:
ENSDARG00000019342
ZFIN ID:
ZDB-GENE-030131-6665
Description:
acetylcholine receptor subunit delta [Source:RefSeq peptide;Acc:NP_996947]
Human Orthologue:
CHRND
Human Description:
cholinergic receptor, nicotinic, delta [Source:HGNC Symbol;Acc:1965]
Mouse Orthologue:
Chrnd
Mouse Description:
cholinergic receptor, nicotinic, delta polypeptide Gene [Source:MGI Symbol;Acc:MGI:87893]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7519 Missense Mutation detected in F1 DNA During 2014
sa5078 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7519
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015391 Missense 240 518 7 12
Genomic Location:
Chromosome 24 (position 25970444)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGCATCCCGAAAGAAAGCAACAAGCACCAGGATATCACCTTTTACCTG[A/T]TCATTAAGCGTAARCCGCTGTTCTACATYGTCAACATAATCATTCCCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5078
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015391 Nonsense 324 518 9 12
Genomic Location:
Chromosome 24 (position 25971454)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTGACAGGTATCTGATGTTTATCATGGTGTTGGTCACTGTGRTGGTGT[T/A]GAATTGTGTCATTGTGTTGAACCTGCATTTTCGGACGCCCAGCACACACG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/65w0vrv8