si:ch211-67e16.5

Ensembl ID:
ENSDARG00000019316
ZFIN ID:
ZDB-GENE-070912-312
Human Orthologue:
FER1L6
Human Description:
fer-1-like 6 (C. elegans) [Source:HGNC Symbol;Acc:28065]
Mouse Orthologue:
Fer1l6
Mouse Description:
fer-1-like 6 (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:3645398]

Alleles

There are 10 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34587 Essential Splice Site Mutation detected in F1 DNA During 2017
sa16199 Nonsense Available for shipment Available now
sa34586 Nonsense Available for shipment Available now
sa2511 Nonsense F2 line generated During 2017
sa34585 Essential Splice Site Mutation detected in F1 DNA During 2017
sa10809 Nonsense Available for shipment Available now
sa18941 Nonsense Mutation detected in F1 DNA During 2017
sa6110 Essential Splice Site Mutation detected in F1 DNA During 2017
sa11129 Nonsense Available for shipment Available now
sa27362 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34587
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056105 Essential Splice Site 161 1810 6 42
ENSDART00000139898   None 52 None 2
ENSDART00000141571 Essential Splice Site 65 322 2 7
ENSDART00000146449   None 367 None 8
ENSDART00000146675   None 576 None 12
Genomic Location (Zv9):
Chromosome 9 (position 14359992)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 14112557
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATATATTGCAATCAAGACATCTTTTTTGACAAAGTCATTAAACTATCA[G/A]TAAGTATTAACATGAACAATAGTTTATTAACATAACCTATAGAGCTCATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16199
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056105 Nonsense 237 1810 8 42
ENSDART00000139898   None 52 None 2
ENSDART00000141571 Nonsense 141 322 4 7
ENSDART00000146449   None 367 None 8
ENSDART00000146675   None 576 None 12
Genomic Location (Zv9):
Chromosome 9 (position 14359603)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 14112168
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAAGGGAGATGTTGCACCACCATCTCAGAAATTCWGTGATGCCGAGGAA[C/T]AAATTGATAAGTAAGATNNCTNNNAGATGTTGAATGCMTCTTTAAAAAAAYTMTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34586
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056105 Nonsense 501 1810 12 42
ENSDART00000139898 Nonsense 28 52 1 2
ENSDART00000141571   None 322 None 7
ENSDART00000146449   None 367 None 8
ENSDART00000146675   None 576 None 12
Genomic Location (Zv9):
Chromosome 9 (position 14356725)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 14109290
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAGGCATCCATGATCGACAGAAAAATTGGCGATAGACCAGTCACCCTA[G/T]AGTTTACGATTGGTAAATATCACATGAATTTTTTTATCTAGTTTGCTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2511
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056105 Nonsense 580 1810 14 42
ENSDART00000139898   None 52 None 2
ENSDART00000141571   None 322 None 7
ENSDART00000146449   None 367 None 8
ENSDART00000146675   None 576 None 12
Genomic Location (Zv9):
Chromosome 9 (position 14353796)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 14106361
KASP Assay ID:
554-3185.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATCGCTGCACAGAAGCCCTGTGTGTATGTTTACAGTAGCTGGGAGGAT[C/T]GAGCGTACCGACTTCATCAYGCCAACATGCTAGACACAATTGCCCTCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34585
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056105 Essential Splice Site 752 1810 18 42
ENSDART00000139898   None 52 None 2
ENSDART00000141571   None 322 None 7
ENSDART00000146449 Essential Splice Site 51 367 1 8
ENSDART00000146675   None 576 None 12
Genomic Location (Zv9):
Chromosome 9 (position 14351947)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 14104512
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAGCAAAGAGGCAGAGACTGTGGGAAGATCAAGACACTGTTCCTCAAG[G/A]TCTGAACTCTATTAAATTCACAGTTTATAGGGTTTTATGTAGTACCGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10809
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056105 Nonsense 1142 1810 27 42
ENSDART00000139898   None 52 None 2
ENSDART00000141571   None 322 None 7
ENSDART00000146449   None 367 None 8
ENSDART00000146675   None 576 None 12
ENSDART00000056105 Nonsense 1142 1810 27 42
ENSDART00000139898   None 52 None 2
ENSDART00000141571   None 322 None 7
ENSDART00000146449   None 367 None 8
ENSDART00000146675   None 576 None 12
Genomic Location (Zv9):
Chromosome 9 (position 14337658)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 14090223
KASP Assay ID:
2260-1615.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTGACTATAAAAACTGTCTATCAATGCCAGGTGTCWAAAAAGAGCAAA[C/T]GAAGATCTACAAAAAGGAAGAAACGCACCACGGYTGAKGAGTCTGCAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18941
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056105 Nonsense 1142 1810 27 42
ENSDART00000139898   None 52 None 2
ENSDART00000141571   None 322 None 7
ENSDART00000146449   None 367 None 8
ENSDART00000146675   None 576 None 12
ENSDART00000056105 Nonsense 1142 1810 27 42
ENSDART00000139898   None 52 None 2
ENSDART00000141571   None 322 None 7
ENSDART00000146449   None 367 None 8
ENSDART00000146675   None 576 None 12
Genomic Location (Zv9):
Chromosome 9 (position 14337658)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 14090223
KASP Assay ID:
2260-1615.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTGACTATAAAAACTGTCTATCAATGCCAGGTGTCAAAAAAGAGCAAA[C/T]GAAGATCTACAAAAAGGAAGAAACGCACCACGGCTGATGAGTCTGCAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6110
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056105 Essential Splice Site 1365 1810 33 42
ENSDART00000139898   None 52 None 2
ENSDART00000141571   None 322 None 7
ENSDART00000146449   None 367 None 8
ENSDART00000146675 Essential Splice Site 131 576 3 12
Genomic Location (Zv9):
Chromosome 9 (position 14330866)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 14083431
KASP Assay ID:
554-3926.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGACAGAGACAATTACATMCCAAAGCAGCTCAACCCRGTGTTTGGAAG[G/A]TGAACAAGCAGATTGATTGAGAATTTATTTCTTCTAACTGCTCATTTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11129
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056105 Nonsense 1375 1810 34 42
ENSDART00000139898   None 52 None 2
ENSDART00000141571   None 322 None 7
ENSDART00000146449   None 367 None 8
ENSDART00000146675 Nonsense 141 576 4 12
Genomic Location (Zv9):
Chromosome 9 (position 14330747)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 14083312
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCGTATTTCTYCCCTGATCAGATCTTTTGAATTTCRAGCCACTTTTCCC[A/T]AAGAMTCCCTACTAACAATCCTAATCTATGACTATGACCTGGTTGGTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27362
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056105 Essential Splice Site 1522 1810 37 42
ENSDART00000139898   None 52 None 2
ENSDART00000141571   None 322 None 7
ENSDART00000146449   None 367 None 8
ENSDART00000146675 Essential Splice Site 288 576 7 12
Genomic Location (Zv9):
Chromosome 9 (position 14329161)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 14081726
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAAGGATTGTTGGTGTGAATATTCTTAATTATTGATTTGTATGTTCCCC[A/T]GGGCCATTTGCAGATGTGGGTGGACATTTTTCCACTGGACATGCCTCACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link