sec14l1

Ensembl ID:
ENSDARG00000019301
ZFIN ID:
ZDB-GENE-040426-801
Human Orthologue:
SEC14L1
Human Description:
SEC14-like 1 (S. cerevisiae) [Source:HGNC Symbol;Acc:10698]
Mouse Orthologue:
Sec14l1
Mouse Description:
SEC14-like 1 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1921386]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33339 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33339
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009973 Nonsense 68 675 2 20
ENSDART00000132110   None 223 None 4
Genomic Location (Zv9):
Chromosome 3 (position 60970904)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 60060780
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGCAGGAGTGGACTACATGTACTTCATCCAGAAGAACTCTCTGAACCGT[A/T]GAGAGAGAACCTTACACATCGAGGCCTATAATGAATCCTTCTCCAGCAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link