ints7

Ensembl ID:
ENSDARG00000019300
ZFIN ID:
ZDB-GENE-021220-6
Description:
Integrator complex subunit 7 [Source:UniProtKB/Swiss-Prot;Acc:Q8JGR7]
Human Orthologue:
INTS7
Human Description:
integrator complex subunit 7 [Source:HGNC Symbol;Acc:24484]
Mouse Orthologue:
Ints7
Mouse Description:
integrator complex subunit 7 Gene [Source:MGI Symbol;Acc:MGI:1924315]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4883 Nonsense F2 line generated During 2017
sa6619 Nonsense Mutation detected in F1 DNA During 2017
sa32279 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa4883
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020703 Nonsense 598 964 13 20

The following transcripts of ENSDARG00000019300 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 12990809)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 13180055
KASP Assay ID:
554-3571.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGACTACAGTGCAGCCATGAGCGCCATCTCTGAAGCACTGAAATCCTAC[C/T]AGAAGGGAATCGCATCTCTCACGGTCAGGATTCACTTTTATTTATTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6619
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020703 Nonsense 666 964 14 20

The following transcripts of ENSDARG00000019300 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 12983163)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 13172409
KASP Assay ID:
554-4958.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGCAACCACGATYGCTCTGTCCTCGGGCAGTGACTTGCAGCGCTGCGGA[C/T]GAATCTCCACACAGGTGCCCAAACACACGCTCCTATTTCTGCTCTYTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32279
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020703 Nonsense 689 964 15 20

The following transcripts of ENSDARG00000019300 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 12982431)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 13171677
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTCCATGGATGAGTTTAGAAGTCTCGCAGCTCGCTATGCTGACCTGTA[C/A]CAGTCTTCGTTTGATGCGGACTATGCCACCCTTCGCAATGTTGAACTGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link