si:dkey-204a24.9

Ensembl ID:
ENSDARG00000019299
ZFIN ID:
ZDB-GENE-041111-214
Description:
Novel protein similar to vertebrate zinc finger protein 592 (ZNF592) [Source:UniProtKB/TrEMBL;Acc:Q1
Human Orthologue:
ZNF687
Human Description:
zinc finger protein 687 [Source:HGNC Symbol;Acc:29277]
Mouse Orthologue:
Zfp687
Mouse Description:
zinc finger protein 687 Gene [Source:MGI Symbol;Acc:MGI:1925516]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23443 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23443
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007137   None 736 None 2
ENSDART00000104703 Essential Splice Site 758 1431 2 9
ENSDART00000123058 Essential Splice Site 758 1393 2 10
ENSDART00000132336 Essential Splice Site 758 1431 3 10
Genomic Location (Zv9):
Chromosome 19 (position 8450912)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 7909451
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAACGCTTAATGTCATACACTCAATGCTGAATGCCAAATGTTCTGTTTGT[A/T]GGTATGCTTTCTCCGTCACTTTCCTCTCCACCTTTGACATCCTCCACTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link