tfdp1a

Ensembl ID:
ENSDARG00000019293
ZFIN ID:
ZDB-GENE-040426-2883
Description:
RNA-binding protein MEX3A [Source:RefSeq peptide;Acc:NP_998657]
Human Orthologues:
TFDP1, TFDP3
Human Descriptions:
transcription factor Dp family, member 3 [Source:HGNC Symbol;Acc:24603]
transcription factor Dp-1 [Source:HGNC Symbol;Acc:11749]
Mouse Orthologue:
Tfdp1
Mouse Description:
transcription factor Dp 1 Gene [Source:MGI Symbol;Acc:MGI:101934]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38753 Essential Splice Site Mutation detected in F1 DNA During 2016
sa41474 Nonsense Mutation detected in F1 DNA During 2016
sa18598 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa38753
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011561 Essential Splice Site 158 409 6 11
ENSDART00000077800 Essential Splice Site 158 409 7 12
ENSDART00000121828 Essential Splice Site 158 188 7 7
ENSDART00000142347 Essential Splice Site 158 229 7 8

The following transcripts of ENSDARG00000019293 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 35933935)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 35153446
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATATATAACATGATAAATAAACCAACGCTTTTGGTTTCTGCTTTTTTCA[G/A]CATGTGTATGACCAGAAGAACATTCGACGGCGTGTGTACGATGCTCTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41474
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011561 Nonsense 166 409 6 11
ENSDART00000077800 Nonsense 166 409 7 12
ENSDART00000121828 Nonsense 166 188 7 7
ENSDART00000142347 Nonsense 166 229 7 8

The following transcripts of ENSDARG00000019293 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 35933960)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 35153471
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGCTTTTGGTTTCTGCTTTTTTCAGCATGTGTATGACCAGAAGAACATT[C/T]GACGGCGTGTGTACGATGCTCTCAATGTGCTGATGGCCATGAACATAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18598
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011561 Essential Splice Site 363 409 10 11
ENSDART00000077800 Essential Splice Site 363 409 11 12
ENSDART00000121828   None 188 None 7
ENSDART00000142347   None 229 None 8

The following transcripts of ENSDARG00000019293 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 35936434)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 35155945
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACGGGGGCTTCAWCYGCAAATGGAGGTGGYCGCTATCAWGTAGGAGGG[T/G]GAGTTTCTTTTGCACATTTTTCTGTTNNNNNNNNNNNNNNNNNNNNNNNNN
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link