lars

Ensembl ID:
ENSDARG00000019280
ZFIN ID:
ZDB-GENE-030114-7
Human Orthologue:
LARS
Human Description:
leucyl-tRNA synthetase [Source:HGNC Symbol;Acc:6512]
Mouse Orthologue:
Lars
Mouse Description:
leucyl-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:1913808]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15597 Nonsense Available for shipment Available now
sa39348 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa15597
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026064 Nonsense 159 821 6 22
ENSDART00000143749 Nonsense 86 748 3 19
Genomic Location (Zv9):
Chromosome 21 (position 39709786)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 41038248
KASP Assay ID:
2261-6048.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTNNNNCTTTTTTTCTTNNNAGGGTGAAGCACTGATTTACATGGAGCCTGAGAAG[C/T]AGGTGTTATCTCGGTCTGCAGACGAGTGTGTTGTGGCWTTGYGTGACCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39348
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026064 Essential Splice Site 755 821 21 22
ENSDART00000143749 Essential Splice Site 682 748 18 19
Genomic Location (Zv9):
Chromosome 21 (position 39679894)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 41008356
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGACAGCATCATTCGCAGACTGTCCCGAGTCAACAGAGGCATCAAGGG[T/C]AAATCTTATTTACATTCGTTTTGGACAGAATAGAAGCTGTAAGAACGATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link