GNB4 (2 of 2)

Ensembl ID:
ENSDARG00000019278
Description:
guanine nucleotide binding protein (G protein), beta polypeptide 4 [Source:HGNC Symbol;Acc:20731]
Human Orthologue:
GNB4
Human Description:
guanine nucleotide binding protein (G protein), beta polypeptide 4 [Source:HGNC Symbol;Acc:20731]
Mouse Orthologue:
Gnb4
Mouse Description:
guanine nucleotide binding protein (G protein), beta 4 Gene [Source:MGI Symbol;Acc:MGI:104581]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32833 Nonsense Mutation detected in F1 DNA During 2017
sa39753 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32833
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019925 Nonsense 13 249 1 7
Genomic Location (Zv9):
Chromosome 2 (position 4531015)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 5388457
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGCTTGGAGGACCATGAGTGAGCTGGAGCAGTTGCGGCAGGAGGCCGAA[C/T]AACTGCGCAATCAGATCAGAGTAAGATCCTATGTGGTTTCAGATCAATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39753
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019925 Nonsense 122 249 5 7
Genomic Location (Zv9):
Chromosome 2 (position 4541141)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 5398583
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCTCCTTCAGGGAATTATGTAGCTTGCGGAGGCCTGGACAACATCTGCT[C/A]AATCTACAGCCTTAAAACCCGCGAGGGCAATGTCAGAGTCACTAGAGAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link